Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0332235442:

Variant ID: vg0332235442 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 32235442
Reference Allele: AAlternative Allele: AT,ATT
Primary Allele: ATSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 318. )

Flanking Sequence (100 bp) in Reference Genome:


TCCGGTTCTCCTCATCTGTGACAGATCACAACTACGTACAATTTGATAGTGTGGAGTACAATATCATCTGCAATACTTTACATCACCAAATCGTCTTAAT[A/AT,ATT]
TTTTTTTTCAAGCTAAGTTCAGCAGTTCTTTCGAGATTACAGGCCTCCTTTTGAACGAAGAAATTTTGCGAAAATTCTACAAAAATTGAACTAATCCATG

Reverse complement sequence

CATGGATTAGTTCAATTTTTGTAGAATTTTCGCAAAATTTCTTCGTTCAAAAGGAGGCCTGTAATCTCGAAAGAACTGCTGAACTTAGCTTGAAAAAAAA[T/AT,AAT]
ATTAAGACGATTTGGTGATGTAAAGTATTGCAGATGATATTGTACTCCACACTATCAAATTGTACGTAGTTGTGATCTGTCACAGATGAGGAGAACCGGA

Allele Frequencies:

Populations Population SizeFrequency of AT(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.60% 35.00% 0.11% 0.28% ATT: 0.02%
All Indica  2759 98.20% 1.30% 0.11% 0.43% NA
All Japonica  1512 1.60% 98.30% 0.13% 0.00% NA
Aus  269 98.90% 0.70% 0.00% 0.00% ATT: 0.37%
Indica I  595 98.80% 0.50% 0.17% 0.50% NA
Indica II  465 96.80% 2.60% 0.00% 0.65% NA
Indica III  913 98.60% 1.20% 0.00% 0.22% NA
Indica Intermediate  786 98.00% 1.30% 0.25% 0.51% NA
Temperate Japonica  767 0.50% 99.20% 0.26% 0.00% NA
Tropical Japonica  504 3.60% 96.40% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 9.40% 90.60% 0.00% 0.00% NA
Intermediate  90 50.00% 48.90% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0332235442 A -> ATT LOC_Os03g56590.1 downstream_gene_variant ; 2511.0bp to feature; MODIFIER silent_mutation Average:84.511; most accessible tissue: Callus, score: 92.509 N N N N
vg0332235442 A -> ATT LOC_Os03g56580.1 intron_variant ; MODIFIER silent_mutation Average:84.511; most accessible tissue: Callus, score: 92.509 N N N N
vg0332235442 A -> DEL N N silent_mutation Average:84.511; most accessible tissue: Callus, score: 92.509 N N N N
vg0332235442 A -> AT LOC_Os03g56590.1 downstream_gene_variant ; 2511.0bp to feature; MODIFIER silent_mutation Average:84.511; most accessible tissue: Callus, score: 92.509 N N N N
vg0332235442 A -> AT LOC_Os03g56580.1 intron_variant ; MODIFIER silent_mutation Average:84.511; most accessible tissue: Callus, score: 92.509 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0332235442 A AT -0.2 -0.04 0.03 -0.06 -0.04 -0.03
vg0332235442 A ATT -0.35 -0.08 -0.07 -0.11 -0.08 -0.09