\
| Variant ID: vg0332136561 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 32136561 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCTATTAGGCCACCTTTGATTCAAAGAAAATTCATAGGAATTTTAGAGGATTTTATTCCTATAGAAATTTTTCCTATATAGCTCTTTGAATTAAAGGAAT[A/G]
GATCTTATGGAATCCTATGAAATTCCTATGGATTGCCTAATGCCATGCAAGTTTTGGAGGAATTCTAACATGAGGTAAAACCTCTTGGAAACTTTCCTTT
AAAGGAAAGTTTCCAAGAGGTTTTACCTCATGTTAGAATTCCTCCAAAACTTGCATGGCATTAGGCAATCCATAGGAATTTCATAGGATTCCATAAGATC[T/C]
ATTCCTTTAATTCAAAGAGCTATATAGGAAAAATTTCTATAGGAATAAAATCCTCTAAAATTCCTATGAATTTTCTTTGAATCAAAGGTGGCCTAATAGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.20% | 11.70% | 23.76% | 17.31% | NA |
| All Indica | 2759 | 40.20% | 0.60% | 35.70% | 23.49% | NA |
| All Japonica | 1512 | 62.20% | 34.60% | 2.65% | 0.53% | NA |
| Aus | 269 | 16.00% | 0.40% | 27.88% | 55.76% | NA |
| Indica I | 595 | 34.30% | 0.00% | 47.56% | 18.15% | NA |
| Indica II | 465 | 37.00% | 2.20% | 40.43% | 20.43% | NA |
| Indica III | 913 | 44.10% | 0.20% | 26.29% | 29.35% | NA |
| Indica Intermediate | 786 | 42.00% | 0.60% | 34.86% | 22.52% | NA |
| Temperate Japonica | 767 | 43.30% | 53.70% | 3.00% | 0.00% | NA |
| Tropical Japonica | 504 | 89.70% | 7.50% | 1.39% | 1.39% | NA |
| Japonica Intermediate | 241 | 65.10% | 30.30% | 4.15% | 0.41% | NA |
| VI/Aromatic | 96 | 91.70% | 2.10% | 2.08% | 4.17% | NA |
| Intermediate | 90 | 55.60% | 12.20% | 23.33% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0332136561 | A -> DEL | N | N | silent_mutation | Average:29.23; most accessible tissue: Callus, score: 54.4 | N | N | N | N |
| vg0332136561 | A -> G | LOC_Os03g56360.1 | upstream_gene_variant ; 4808.0bp to feature; MODIFIER | silent_mutation | Average:29.23; most accessible tissue: Callus, score: 54.4 | N | N | N | N |
| vg0332136561 | A -> G | LOC_Os03g56370.1 | downstream_gene_variant ; 327.0bp to feature; MODIFIER | silent_mutation | Average:29.23; most accessible tissue: Callus, score: 54.4 | N | N | N | N |
| vg0332136561 | A -> G | LOC_Os03g56360-LOC_Os03g56370 | intergenic_region ; MODIFIER | silent_mutation | Average:29.23; most accessible tissue: Callus, score: 54.4 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0332136561 | NA | 3.22E-08 | mr1002 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0332136561 | NA | 4.13E-06 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0332136561 | 6.15E-07 | 8.62E-13 | mr1002_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0332136561 | NA | 3.99E-08 | mr1002_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0332136561 | NA | 1.36E-12 | mr1182_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0332136561 | NA | 5.36E-10 | mr1282_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0332136561 | NA | 1.09E-07 | mr1681_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |