\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0332136561:

Variant ID: vg0332136561 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 32136561
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTATTAGGCCACCTTTGATTCAAAGAAAATTCATAGGAATTTTAGAGGATTTTATTCCTATAGAAATTTTTCCTATATAGCTCTTTGAATTAAAGGAAT[A/G]
GATCTTATGGAATCCTATGAAATTCCTATGGATTGCCTAATGCCATGCAAGTTTTGGAGGAATTCTAACATGAGGTAAAACCTCTTGGAAACTTTCCTTT

Reverse complement sequence

AAAGGAAAGTTTCCAAGAGGTTTTACCTCATGTTAGAATTCCTCCAAAACTTGCATGGCATTAGGCAATCCATAGGAATTTCATAGGATTCCATAAGATC[T/C]
ATTCCTTTAATTCAAAGAGCTATATAGGAAAAATTTCTATAGGAATAAAATCCTCTAAAATTCCTATGAATTTTCTTTGAATCAAAGGTGGCCTAATAGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.20% 11.70% 23.76% 17.31% NA
All Indica  2759 40.20% 0.60% 35.70% 23.49% NA
All Japonica  1512 62.20% 34.60% 2.65% 0.53% NA
Aus  269 16.00% 0.40% 27.88% 55.76% NA
Indica I  595 34.30% 0.00% 47.56% 18.15% NA
Indica II  465 37.00% 2.20% 40.43% 20.43% NA
Indica III  913 44.10% 0.20% 26.29% 29.35% NA
Indica Intermediate  786 42.00% 0.60% 34.86% 22.52% NA
Temperate Japonica  767 43.30% 53.70% 3.00% 0.00% NA
Tropical Japonica  504 89.70% 7.50% 1.39% 1.39% NA
Japonica Intermediate  241 65.10% 30.30% 4.15% 0.41% NA
VI/Aromatic  96 91.70% 2.10% 2.08% 4.17% NA
Intermediate  90 55.60% 12.20% 23.33% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0332136561 A -> DEL N N silent_mutation Average:29.23; most accessible tissue: Callus, score: 54.4 N N N N
vg0332136561 A -> G LOC_Os03g56360.1 upstream_gene_variant ; 4808.0bp to feature; MODIFIER silent_mutation Average:29.23; most accessible tissue: Callus, score: 54.4 N N N N
vg0332136561 A -> G LOC_Os03g56370.1 downstream_gene_variant ; 327.0bp to feature; MODIFIER silent_mutation Average:29.23; most accessible tissue: Callus, score: 54.4 N N N N
vg0332136561 A -> G LOC_Os03g56360-LOC_Os03g56370 intergenic_region ; MODIFIER silent_mutation Average:29.23; most accessible tissue: Callus, score: 54.4 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0332136561 NA 3.22E-08 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332136561 NA 4.13E-06 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332136561 6.15E-07 8.62E-13 mr1002_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332136561 NA 3.99E-08 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332136561 NA 1.36E-12 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332136561 NA 5.36E-10 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0332136561 NA 1.09E-07 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251