\
| Variant ID: vg0329241236 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 29241236 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 113. )
ATAGCTCAATTTCATAGGAAAATAAGCAAGAGGTTCAACCTCTTGGAAACTATCATTTTACTTTGTTTGTTTCCTATGGTGCTATCAAAGAGACCCTCTT[C/T]
ATATTTCCTGTGTTTTTCATTCCTATAGGATTAGAAAAACATACCACTCCAATTCCTATGTTTTTTCTATTCCTTTGTTTTTCCTATCCTACGTTTCAAA
TTTGAAACGTAGGATAGGAAAAACAAAGGAATAGAAAAAACATAGGAATTGGAGTGGTATGTTTTTCTAATCCTATAGGAATGAAAAACACAGGAAATAT[G/A]
AAGAGGGTCTCTTTGATAGCACCATAGGAAACAAACAAAGTAAAATGATAGTTTCCAAGAGGTTGAACCTCTTGCTTATTTTCCTATGAAATTGAGCTAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.50% | 14.50% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 83.00% | 16.90% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 33.50% | 66.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 59.90% | 39.90% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 75.00% | 25.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 12.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0329241236 | C -> T | LOC_Os03g51110.1 | downstream_gene_variant ; 2854.0bp to feature; MODIFIER | silent_mutation | Average:53.41; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| vg0329241236 | C -> T | LOC_Os03g51120.1 | downstream_gene_variant ; 1398.0bp to feature; MODIFIER | silent_mutation | Average:53.41; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| vg0329241236 | C -> T | LOC_Os03g51110-LOC_Os03g51120 | intergenic_region ; MODIFIER | silent_mutation | Average:53.41; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0329241236 | NA | 1.61E-06 | mr1028 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0329241236 | NA | 3.74E-06 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0329241236 | NA | 2.86E-06 | mr1073 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0329241236 | NA | 2.78E-06 | mr1153 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0329241236 | NA | 2.64E-07 | mr1369 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0329241236 | NA | 5.20E-08 | mr1393 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0329241236 | NA | 2.88E-08 | mr1403 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0329241236 | NA | 7.02E-07 | mr1417 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0329241236 | NA | 2.61E-08 | mr1453 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0329241236 | NA | 2.30E-06 | mr1574 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0329241236 | NA | 1.78E-11 | mr1612 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0329241236 | NA | 1.31E-07 | mr1652 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0329241236 | NA | 4.41E-08 | mr1706 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0329241236 | NA | 2.59E-11 | mr1730 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0329241236 | NA | 2.11E-08 | mr1989 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |