Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0328947425:

Variant ID: vg0328947425 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 28947425
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.60, T: 0.39, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


CCACGCGCGCCCGGTGGCCACGCCCGGATCTCATCTCATGCCTAGTAGCAGCCACGACGACGACGCAAACGCCACGCCGGATCTCATCTCATCTCACCGG[T/C]
GGCGGCGGCGGCGGCGACGGGCGGTGGGGGCTTGAAGAGGAGCTCGTCGCCGTCGGGATGCACCAACTATGACCCCGGAGGCGGCGGCGCCGGCATTTGT

Reverse complement sequence

ACAAATGCCGGCGCCGCCGCCTCCGGGGTCATAGTTGGTGCATCCCGACGGCGACGAGCTCCTCTTCAAGCCCCCACCGCCCGTCGCCGCCGCCGCCGCC[A/G]
CCGGTGAGATGAGATGAGATCCGGCGTGGCGTTTGCGTCGTCGTCGTGGCTGCTACTAGGCATGAGATGAGATCCGGGCGTGGCCACCGGGCGCGCGTGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.70% 17.60% 3.72% 4.02% NA
All Indica  2759 67.80% 19.60% 5.84% 6.74% NA
All Japonica  1512 99.50% 0.30% 0.07% 0.07% NA
Aus  269 1.90% 95.50% 2.60% 0.00% NA
Indica I  595 91.10% 7.10% 1.01% 0.84% NA
Indica II  465 41.50% 30.10% 10.54% 17.85% NA
Indica III  913 65.50% 22.10% 7.56% 4.82% NA
Indica Intermediate  786 68.40% 20.00% 4.71% 6.87% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.40% 0.00% 0.20% NA
Japonica Intermediate  241 99.20% 0.40% 0.41% 0.00% NA
VI/Aromatic  96 85.40% 12.50% 1.04% 1.04% NA
Intermediate  90 73.30% 17.80% 6.67% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0328947425 T -> C LOC_Os03g50690.1 upstream_gene_variant ; 2673.0bp to feature; MODIFIER silent_mutation Average:73.864; most accessible tissue: Zhenshan97 flower, score: 89.268 N N N N
vg0328947425 T -> C LOC_Os03g50690-LOC_Os03g50710 intergenic_region ; MODIFIER silent_mutation Average:73.864; most accessible tissue: Zhenshan97 flower, score: 89.268 N N N N
vg0328947425 T -> DEL N N silent_mutation Average:73.864; most accessible tissue: Zhenshan97 flower, score: 89.268 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0328947425 T C 0.1 0.08 0.07 0.02 0.05 0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0328947425 1.39E-07 NA mr1003 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328947425 5.10E-07 4.85E-09 mr1003 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328947425 NA 4.55E-06 mr1006 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328947425 NA 1.92E-06 mr1010 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328947425 2.65E-07 NA mr1051 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328947425 3.00E-07 4.26E-09 mr1051 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328947425 NA 4.69E-06 mr1052 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328947425 NA 1.94E-06 mr1163 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328947425 NA 5.94E-06 mr1192 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328947425 NA 2.84E-09 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328947425 9.49E-06 NA mr1536 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328947425 3.73E-06 1.90E-07 mr1536 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328947425 NA 8.87E-06 mr1671 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328947425 NA 3.42E-06 mr1931 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328947425 NA 3.84E-06 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328947425 NA 2.09E-10 mr1193_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328947425 NA 1.07E-06 mr1952_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251