Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0328922349:

Variant ID: vg0328922349 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 28922349
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.69, A: 0.31, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


CTCGACCTCGTGGTATTGCGCCTGCATCCCTCGTCGACAGTGTTCGTCCCCGCGTGGTTTTCCTCCTCTAGTGCACCGCGATCTTAATTTTATAAAATTT[A/G]
TGACACGACTACAAATAAACGAATTGTAATAATACTTATCTGAAATGATATATTTGCAATGGTATGGATTAAATTAACCCATCAAATTAAGGGAGCCTTA

Reverse complement sequence

TAAGGCTCCCTTAATTTGATGGGTTAATTTAATCCATACCATTGCAAATATATCATTTCAGATAAGTATTATTACAATTCGTTTATTTGTAGTCGTGTCA[T/C]
AAATTTTATAAAATTAAGATCGCGGTGCACTAGAGGAGGAAAACCACGCGGGGACGAACACTGTCGACGAGGGATGCAGGCGCAATACCACGAGGTCGAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.20% 25.40% 0.06% 0.34% NA
All Indica  2759 66.90% 32.50% 0.07% 0.54% NA
All Japonica  1512 99.50% 0.40% 0.07% 0.00% NA
Aus  269 2.20% 97.80% 0.00% 0.00% NA
Indica I  595 90.40% 9.40% 0.00% 0.17% NA
Indica II  465 39.60% 58.90% 0.00% 1.51% NA
Indica III  913 65.20% 34.40% 0.22% 0.22% NA
Indica Intermediate  786 67.30% 32.10% 0.00% 0.64% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.60% 0.20% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 71.10% 27.80% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0328922349 A -> DEL N N silent_mutation Average:53.465; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg0328922349 A -> G LOC_Os03g50644.1 downstream_gene_variant ; 4643.0bp to feature; MODIFIER silent_mutation Average:53.465; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg0328922349 A -> G LOC_Os03g50644-LOC_Os03g50660 intergenic_region ; MODIFIER silent_mutation Average:53.465; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0328922349 6.34E-06 NA mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328922349 6.11E-06 2.90E-08 mr1003 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328922349 NA 7.01E-06 mr1010 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328922349 3.07E-06 NA mr1051 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328922349 1.34E-06 1.20E-08 mr1051 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328922349 NA 5.80E-06 mr1163 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328922349 NA 1.45E-08 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328922349 4.52E-06 2.06E-07 mr1536 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328922349 NA 6.62E-06 mr1671 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328922349 NA 3.43E-06 mr1745 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328922349 7.55E-06 7.55E-06 mr1832 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328922349 NA 1.92E-06 mr1931 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328922349 NA 1.64E-06 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0328922349 NA 1.48E-06 mr1952_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251