\
| Variant ID: vg0327968455 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 27968455 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.10, others allele: 0.00, population size: 97. )
GCTTACATAACGATATATACATTTTTACAAGTTGGCGATTTGGGTGCCACCCGTTCTAGACATAGAAACGCTTGAGAGAGGCAGCGTTCCAGGAATGGTC[G/A]
AAATCTTAGCCTTCCAGTGTCGCCAGTCGAAAGGATCCCGTCCTGGATTTGTGCTTGATGAGGTACGGTCCTTCCCACTTCGATTCAAGCTTGCCAACGG
CCGTTGGCAAGCTTGAATCGAAGTGGGAAGGACCGTACCTCATCAAGCACAAATCCAGGACGGGATCCTTTCGACTGGCGACACTGGAAGGCTAAGATTT[C/T]
GACCATTCCTGGAACGCTGCCTCTCTCAAGCGTTTCTATGTCTAGAACGGGTGGCACCCAAATCGCCAACTTGTAAAAATGTATATATCGTTATGTAAGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.10% | 48.60% | 0.30% | 0.00% | NA |
| All Indica | 2759 | 28.50% | 71.00% | 0.47% | 0.00% | NA |
| All Japonica | 1512 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 7.20% | 92.30% | 0.50% | 0.00% | NA |
| Indica II | 465 | 53.50% | 46.00% | 0.43% | 0.00% | NA |
| Indica III | 913 | 26.70% | 72.80% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 31.80% | 67.70% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 96.00% | 4.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 78.10% | 21.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 35.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0327968455 | G -> A | LOC_Os03g49090.1 | downstream_gene_variant ; 1043.0bp to feature; MODIFIER | silent_mutation | Average:34.903; most accessible tissue: Minghui63 root, score: 51.763 | N | N | N | N |
| vg0327968455 | G -> A | LOC_Os03g49100.1 | downstream_gene_variant ; 582.0bp to feature; MODIFIER | silent_mutation | Average:34.903; most accessible tissue: Minghui63 root, score: 51.763 | N | N | N | N |
| vg0327968455 | G -> A | LOC_Os03g49110.1 | downstream_gene_variant ; 4261.0bp to feature; MODIFIER | silent_mutation | Average:34.903; most accessible tissue: Minghui63 root, score: 51.763 | N | N | N | N |
| vg0327968455 | G -> A | LOC_Os03g49090-LOC_Os03g49100 | intergenic_region ; MODIFIER | silent_mutation | Average:34.903; most accessible tissue: Minghui63 root, score: 51.763 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0327968455 | 2.70E-06 | 1.30E-07 | mr1030_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327968455 | 1.33E-06 | 2.89E-07 | mr1030_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327968455 | 4.45E-06 | 4.45E-06 | mr1303_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327968455 | 4.82E-06 | 3.82E-06 | mr1358_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327968455 | 7.91E-06 | 5.86E-06 | mr1366_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327968455 | 2.63E-06 | 1.01E-06 | mr1381_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327968455 | 8.41E-06 | 1.97E-09 | mr1446_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327968455 | 3.17E-06 | 1.99E-08 | mr1446_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327968455 | 5.17E-06 | 5.57E-06 | mr1469_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327968455 | NA | 5.92E-06 | mr1486_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327968455 | 8.45E-06 | 9.00E-06 | mr1629_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327968455 | NA | 9.42E-06 | mr1637_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327968455 | 3.29E-06 | 3.53E-06 | mr1743_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327968455 | 4.22E-06 | 4.22E-06 | mr1819_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327968455 | 6.10E-06 | 6.10E-06 | mr1821_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |