\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0327968455:

Variant ID: vg0327968455 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 27968455
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.10, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


GCTTACATAACGATATATACATTTTTACAAGTTGGCGATTTGGGTGCCACCCGTTCTAGACATAGAAACGCTTGAGAGAGGCAGCGTTCCAGGAATGGTC[G/A]
AAATCTTAGCCTTCCAGTGTCGCCAGTCGAAAGGATCCCGTCCTGGATTTGTGCTTGATGAGGTACGGTCCTTCCCACTTCGATTCAAGCTTGCCAACGG

Reverse complement sequence

CCGTTGGCAAGCTTGAATCGAAGTGGGAAGGACCGTACCTCATCAAGCACAAATCCAGGACGGGATCCTTTCGACTGGCGACACTGGAAGGCTAAGATTT[C/T]
GACCATTCCTGGAACGCTGCCTCTCTCAAGCGTTTCTATGTCTAGAACGGGTGGCACCCAAATCGCCAACTTGTAAAAATGTATATATCGTTATGTAAGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.10% 48.60% 0.30% 0.00% NA
All Indica  2759 28.50% 71.00% 0.47% 0.00% NA
All Japonica  1512 98.10% 1.90% 0.00% 0.00% NA
Aus  269 5.20% 94.80% 0.00% 0.00% NA
Indica I  595 7.20% 92.30% 0.50% 0.00% NA
Indica II  465 53.50% 46.00% 0.43% 0.00% NA
Indica III  913 26.70% 72.80% 0.44% 0.00% NA
Indica Intermediate  786 31.80% 67.70% 0.51% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 96.00% 4.00% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 78.10% 21.90% 0.00% 0.00% NA
Intermediate  90 63.30% 35.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0327968455 G -> A LOC_Os03g49090.1 downstream_gene_variant ; 1043.0bp to feature; MODIFIER silent_mutation Average:34.903; most accessible tissue: Minghui63 root, score: 51.763 N N N N
vg0327968455 G -> A LOC_Os03g49100.1 downstream_gene_variant ; 582.0bp to feature; MODIFIER silent_mutation Average:34.903; most accessible tissue: Minghui63 root, score: 51.763 N N N N
vg0327968455 G -> A LOC_Os03g49110.1 downstream_gene_variant ; 4261.0bp to feature; MODIFIER silent_mutation Average:34.903; most accessible tissue: Minghui63 root, score: 51.763 N N N N
vg0327968455 G -> A LOC_Os03g49090-LOC_Os03g49100 intergenic_region ; MODIFIER silent_mutation Average:34.903; most accessible tissue: Minghui63 root, score: 51.763 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0327968455 2.70E-06 1.30E-07 mr1030_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327968455 1.33E-06 2.89E-07 mr1030_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327968455 4.45E-06 4.45E-06 mr1303_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327968455 4.82E-06 3.82E-06 mr1358_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327968455 7.91E-06 5.86E-06 mr1366_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327968455 2.63E-06 1.01E-06 mr1381_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327968455 8.41E-06 1.97E-09 mr1446_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327968455 3.17E-06 1.99E-08 mr1446_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327968455 5.17E-06 5.57E-06 mr1469_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327968455 NA 5.92E-06 mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327968455 8.45E-06 9.00E-06 mr1629_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327968455 NA 9.42E-06 mr1637_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327968455 3.29E-06 3.53E-06 mr1743_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327968455 4.22E-06 4.22E-06 mr1819_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327968455 6.10E-06 6.10E-06 mr1821_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251