| Variant ID: vg0327580144 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 27580144 |
| Reference Allele: C | Alternative Allele: A,T |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.02, A: 0.02, others allele: 0.00, population size: 107. )
AACCCAGAAGCAAGGAGACGGATGGTAAGAAATTCATGTGGCATACTGAGGGTCTGTTTGGTTGGGTATTTCAACTTACCATATTTCAAGTTAGCACATG[C/A,T]
CAAAAGTGTGGCGAACAAAATCCTTGCCATATCTTTGGCTCAAAAATATGTGGCAAAGCAGCAAGAAGCTGTCTAGCTTTCTTTGGCAGACTAAACTATG
CATAGTTTAGTCTGCCAAAGAAAGCTAGACAGCTTCTTGCTGCTTTGCCACATATTTTTGAGCCAAAGATATGGCAAGGATTTTGTTCGCCACACTTTTG[G/T,A]
CATGTGCTAACTTGAAATATGGTAAGTTGAAATACCCAACCAAACAGACCCTCAGTATGCCACATGAATTTCTTACCATCCGTCTCCTTGCTTCTGGGTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.30% | 39.00% | 1.67% | 5.97% | T: 0.08% |
| All Indica | 2759 | 22.30% | 65.10% | 2.54% | 10.08% | NA |
| All Japonica | 1512 | 98.10% | 1.30% | 0.53% | 0.00% | T: 0.07% |
| Aus | 269 | 97.00% | 2.60% | 0.00% | 0.00% | T: 0.37% |
| Indica I | 595 | 5.20% | 47.10% | 7.56% | 40.17% | NA |
| Indica II | 465 | 57.00% | 40.60% | 1.51% | 0.86% | NA |
| Indica III | 913 | 10.70% | 88.50% | 0.33% | 0.44% | NA |
| Indica Intermediate | 786 | 28.20% | 65.90% | 1.91% | 3.94% | NA |
| Temperate Japonica | 767 | 98.00% | 1.20% | 0.78% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.90% | 2.90% | 0.83% | 0.00% | T: 0.41% |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 20.00% | 1.11% | 4.44% | T: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0327580144 | C -> T | LOC_Os03g48430.1 | downstream_gene_variant ; 765.0bp to feature; MODIFIER | silent_mutation | Average:43.827; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| vg0327580144 | C -> T | LOC_Os03g48440.1 | downstream_gene_variant ; 3741.0bp to feature; MODIFIER | silent_mutation | Average:43.827; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| vg0327580144 | C -> T | LOC_Os03g48410-LOC_Os03g48430 | intergenic_region ; MODIFIER | silent_mutation | Average:43.827; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| vg0327580144 | C -> A | LOC_Os03g48430.1 | downstream_gene_variant ; 765.0bp to feature; MODIFIER | silent_mutation | Average:43.827; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| vg0327580144 | C -> A | LOC_Os03g48440.1 | downstream_gene_variant ; 3741.0bp to feature; MODIFIER | silent_mutation | Average:43.827; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| vg0327580144 | C -> A | LOC_Os03g48410-LOC_Os03g48430 | intergenic_region ; MODIFIER | silent_mutation | Average:43.827; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| vg0327580144 | C -> DEL | N | N | silent_mutation | Average:43.827; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0327580144 | 9.97E-10 | 3.72E-07 | mr1193 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327580144 | 2.05E-09 | 1.21E-14 | mr1193 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327580144 | NA | 7.69E-06 | mr1632 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327580144 | NA | 4.80E-06 | mr1693 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327580144 | 1.60E-10 | NA | mr1193_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327580144 | 2.19E-10 | 9.43E-13 | mr1193_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327580144 | NA | 1.32E-13 | mr1514_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327580144 | NA | 1.33E-07 | mr1754_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/