| Variant ID: vg0326981451 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr03 | Position: 26981451 |
| Reference Allele: TC | Alternative Allele: T,CC |
| Primary Allele: CC | Secondary Allele: TC |
Inferred Ancestral Allele: Not determined.
CGATTCAATATGTTAAATCAGTTCTGGAATGAACAATTCCAAAATTAAGAATGTCTACAAAAAAAAAGCTTATTCTTCACTATAACACAATTCCATGTTT[TC/T,CC]
CCCCCCTTGTTCTCAGGGAACGTTGGAATAGCACGACTGTTGTTATCTAAAGGAGCTAGTGTTGATGTATCTTCTTCTGAAGGGACACCACTTCATGTTG
CAACATGAAGTGGTGTCCCTTCAGAAGAAGATACATCAACACTAGCTCCTTTAGATAACAACAGTCGTGCTATTCCAACGTTCCCTGAGAACAAGGGGGG[GA/A,GG]
AAACATGGAATTGTGTTATAGTGAAGAATAAGCTTTTTTTTTGTAGACATTCTTAATTTTGGAATTGTTCATTCCAGAACTGATTTAACATATTGAATCG
| Populations | Population Size | Frequency of CC(primary allele) | Frequency of TC(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.00% | 17.50% | 13.44% | 6.43% | T: 14.68% |
| All Indica | 2759 | 75.50% | 0.70% | 9.17% | 0.11% | T: 14.53% |
| All Japonica | 1512 | 6.90% | 51.30% | 22.49% | 18.98% | T: 0.33% |
| Aus | 269 | 14.50% | 1.10% | 1.12% | 0.00% | T: 83.27% |
| Indica I | 595 | 47.60% | 1.30% | 21.51% | 0.00% | T: 29.58% |
| Indica II | 465 | 89.20% | 0.40% | 7.10% | 0.00% | T: 3.23% |
| Indica III | 913 | 88.60% | 0.40% | 1.42% | 0.11% | T: 9.42% |
| Indica Intermediate | 786 | 73.20% | 0.80% | 10.05% | 0.25% | T: 15.78% |
| Temperate Japonica | 767 | 1.40% | 89.80% | 5.35% | 3.26% | T: 0.13% |
| Tropical Japonica | 504 | 14.30% | 1.60% | 43.85% | 39.88% | T: 0.40% |
| Japonica Intermediate | 241 | 9.10% | 32.40% | 32.37% | 25.31% | T: 0.83% |
| VI/Aromatic | 96 | 6.20% | 13.50% | 20.83% | 10.42% | T: 48.96% |
| Intermediate | 90 | 40.00% | 15.60% | 21.11% | 4.44% | T: 18.89% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0326981451 | TC -> T | LOC_Os03g47640.1 | intron_variant ; MODIFIER | silent_mutation | Average:50.04; most accessible tissue: Zhenshan97 young leaf, score: 63.653 | N | N | N | N |
| vg0326981451 | TC -> DEL | N | N | silent_mutation | Average:50.04; most accessible tissue: Zhenshan97 young leaf, score: 63.653 | N | N | N | N |
| vg0326981451 | TC -> CC | LOC_Os03g47640.1 | intron_variant ; MODIFIER | silent_mutation | Average:50.04; most accessible tissue: Zhenshan97 young leaf, score: 63.653 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0326981451 | NA | 5.52E-14 | Spikelet_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0326981451 | NA | 4.65E-07 | Spikelet_length | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0326981451 | NA | 6.11E-12 | Spikelet_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0326981451 | NA | 2.26E-08 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326981451 | 3.93E-06 | NA | mr1115 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326981451 | NA | 2.25E-19 | mr1115 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326981451 | NA | 4.25E-06 | mr1130 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326981451 | NA | 1.15E-06 | mr1206 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326981451 | NA | 2.94E-07 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326981451 | NA | 5.72E-07 | mr1236 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/