Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0325722534:

Variant ID: vg0325722534 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 25722534
Reference Allele: C	Alternative Allele: A,T
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:

TGAGGCAAATACAATAGAATACAATTTTTTAAAATGTATATATTTTTCAAAGAGTGGAACAAATAATTTATATACTTGTTTTAATAATCTCTACTCGCTC[C/A,T]
ATCCGCAAATATAAGAGATTTTAAGTGGATGTGACACTCATAGTACAATGAATCTGGACATATTTTATGTCCATATTCATTGTACAGGAATAGAAAATCT

Reverse complement sequence

AGATTTTCTATTCCTGTACAATGAATATGGACATAAAATATGTCCAGATTCATTGTACTATGAGTGTCACATCCACTTAAAATCTCTTATATTTGCGGAT[G/T,A]
GAGCGAGTAGAGATTATTAAAACAAGTATATAAATTATTTGTTCCACTCTTTGAAAAATATATACATTTTAAAAAATTGTATTCTATTGTATTTGCCTCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.90%	2.40%	1.29%	0.44%	T: 0.02%
All Indica	2759	93.80%	4.00%	2.14%	0.00%	T: 0.04%
All Japonica	1512	99.90%	0.10%	0.07%	0.00%	NA
Aus	269	99.30%	0.00%	0.00%	0.74%	NA
Indica I	595	83.90%	9.90%	6.22%	0.00%	NA
Indica II	465	96.30%	3.00%	0.65%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	92.60%	4.80%	2.42%	0.00%	T: 0.13%
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.40%	0.41%	0.00%	NA
VI/Aromatic	96	83.30%	0.00%	0.00%	16.67%	NA
Intermediate	90	95.60%	0.00%	1.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0325722534	C -> T	LOC_Os03g45570.1	upstream_gene_variant ; 270.0bp to feature; MODIFIER	silent_mutation	Average:32.723; most accessible tissue: Callus, score: 68.365	N	N	N	N
vg0325722534	C -> T	LOC_Os03g45580.1	upstream_gene_variant ; 2548.0bp to feature; MODIFIER	silent_mutation	Average:32.723; most accessible tissue: Callus, score: 68.365	N	N	N	N
vg0325722534	C -> T	LOC_Os03g45590.1	upstream_gene_variant ; 4376.0bp to feature; MODIFIER	silent_mutation	Average:32.723; most accessible tissue: Callus, score: 68.365	N	N	N	N
vg0325722534	C -> T	LOC_Os03g45570-LOC_Os03g45580	intergenic_region ; MODIFIER	silent_mutation	Average:32.723; most accessible tissue: Callus, score: 68.365	N	N	N	N
vg0325722534	C -> A	LOC_Os03g45570.1	upstream_gene_variant ; 270.0bp to feature; MODIFIER	silent_mutation	Average:32.723; most accessible tissue: Callus, score: 68.365	N	N	N	N
vg0325722534	C -> A	LOC_Os03g45580.1	upstream_gene_variant ; 2548.0bp to feature; MODIFIER	silent_mutation	Average:32.723; most accessible tissue: Callus, score: 68.365	N	N	N	N
vg0325722534	C -> A	LOC_Os03g45590.1	upstream_gene_variant ; 4376.0bp to feature; MODIFIER	silent_mutation	Average:32.723; most accessible tissue: Callus, score: 68.365	N	N	N	N
vg0325722534	C -> A	LOC_Os03g45570-LOC_Os03g45580	intergenic_region ; MODIFIER	silent_mutation	Average:32.723; most accessible tissue: Callus, score: 68.365	N	N	N	N
vg0325722534	C -> DEL	N	N	silent_mutation	Average:32.723; most accessible tissue: Callus, score: 68.365	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0325722534	NA	1.04E-07	Spikelet_length	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0325722534	1.11E-08	2.82E-14	mr1038	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325722534	1.28E-07	5.50E-14	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325722534	2.43E-08	1.39E-15	mr1389	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325722534	2.22E-07	5.62E-14	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325722534	NA	1.43E-06	mr1553	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325722534	3.98E-11	2.41E-19	mr1038_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325722534	1.12E-09	2.18E-17	mr1038_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325722534	NA	3.84E-06	mr1045_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325722534	2.04E-08	NA	mr1141_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325722534	1.93E-07	NA	mr1141_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325722534	NA	1.06E-06	mr1359_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325722534	NA	4.58E-07	mr1359_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325722534	NA	2.24E-06	mr1378_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325722534	1.06E-11	1.31E-16	mr1389_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325722534	3.49E-10	8.91E-16	mr1389_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325722534	NA	6.52E-06	mr1520_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325722534	NA	3.10E-08	mr1968_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251