\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0325710457:

Variant ID: vg0325710457 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 25710457
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCATCTTCTTTTTGTTTCCCAAAAGGGCACCGAGCATAGATAACAGAGCTTGTTATGTTACCACAAGTATAGCAGGGGGCACGCATACGGTTGAGTTGAG[G/T]
CATGTCTAGTGGTGGCGGCCACCATTGTTAATAGTACTCAACTTCCTACTTATTGATGCAATCATCTTTGAGGGTACCGATAGTGAACCAGGATTAATTA

Reverse complement sequence

TAATTAATCCTGGTTCACTATCGGTACCCTCAAAGATGATTGCATCAATAAGTAGGAAGTTGAGTACTATTAACAATGGTGGCCGCCACCACTAGACATG[C/A]
CTCAACTCAACCGTATGCGTGCCCCCTGCTATACTTGTGGTAACATAACAAGCTCTGTTATCTATGCTCGGTGCCCTTTTGGGAAACAAAAAGAAGATGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.80% 3.20% 1.65% 0.38% NA
All Indica  2759 98.70% 0.10% 1.20% 0.00% NA
All Japonica  1512 87.50% 9.70% 2.78% 0.00% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 97.30% 0.00% 2.69% 0.00% NA
Indica II  465 98.10% 0.40% 1.51% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 98.60% 0.10% 1.27% 0.00% NA
Temperate Japonica  767 78.70% 16.40% 4.82% 0.00% NA
Tropical Japonica  504 99.40% 0.00% 0.60% 0.00% NA
Japonica Intermediate  241 90.50% 8.70% 0.83% 0.00% NA
VI/Aromatic  96 84.40% 0.00% 2.08% 13.54% NA
Intermediate  90 93.30% 1.10% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0325710457 G -> T LOC_Os03g45560.1 upstream_gene_variant ; 4428.0bp to feature; MODIFIER silent_mutation Average:46.841; most accessible tissue: Zhenshan97 young leaf, score: 67.83 N N N N
vg0325710457 G -> T LOC_Os03g45560-LOC_Os03g45570 intergenic_region ; MODIFIER silent_mutation Average:46.841; most accessible tissue: Zhenshan97 young leaf, score: 67.83 N N N N
vg0325710457 G -> DEL N N silent_mutation Average:46.841; most accessible tissue: Zhenshan97 young leaf, score: 67.83 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0325710457 2.72E-13 2.72E-13 mr1166 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325710457 2.35E-31 2.20E-38 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325710457 1.71E-06 NA mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325710457 NA 4.32E-06 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325710457 2.47E-32 6.18E-38 mr1305 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325710457 NA 5.25E-06 mr1358 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325710457 1.24E-09 4.63E-11 mr1379 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325710457 2.71E-18 2.71E-18 mr1409 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325710457 1.04E-11 1.94E-15 mr1515 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325710457 1.14E-12 7.63E-11 mr1559 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325710457 5.23E-31 2.06E-40 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325710457 9.99E-34 1.07E-40 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325710457 2.06E-10 2.06E-10 mr1649 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325710457 3.21E-07 3.21E-07 mr1703 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325710457 4.19E-20 8.11E-24 mr1765 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325710457 1.54E-07 8.39E-09 mr1793 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325710457 8.11E-10 8.11E-10 mr1166_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325710457 1.35E-31 1.45E-36 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325710457 4.69E-10 2.89E-08 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325710457 7.94E-14 7.59E-16 mr1409_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325710457 3.40E-13 2.25E-13 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325710457 7.88E-35 6.02E-46 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325710457 3.72E-08 3.72E-08 mr1649_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325710457 4.22E-11 5.99E-13 mr1703_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325710457 4.94E-08 2.12E-11 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325710457 2.25E-09 5.03E-12 mr1793_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251