Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0325696417:

Variant ID: vg0325696417 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 25696417
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATAAAATTTCATTAAAAACTTTGCTTAATTCTATAATTCCTAGATTTTTCTGGGATTTATTTGAGCTAAGGAAGTATTTTTAATAAATGGAATTGCATTT[C/T]
ATGAATAATTTAAATTAGAAAAGGTTTTAAAAGTTCTCTTTTGGCTTTGGGCCGAAAGTCGGCCCAAAACCCTCTCTCTCTCTTCCTCGGCCCAGTCGGC

Reverse complement sequence

GCCGACTGGGCCGAGGAAGAGAGAGAGAGGGTTTTGGGCCGACTTTCGGCCCAAAGCCAAAAGAGAACTTTTAAAACCTTTTCTAATTTAAATTATTCAT[G/A]
AAATGCAATTCCATTTATTAAAAATACTTCCTTAGCTCAAATAAATCCCAGAAAAATCTAGGAATTATAGAATTAAGCAAAGTTTTTAATGAAATTTTAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.00%	2.20%	4.57%	11.28%	NA
All Indica	2759	96.70%	0.00%	1.09%	2.14%	NA
All Japonica	1512	59.20%	6.60%	8.66%	25.53%	NA
Aus	269	75.80%	0.00%	7.81%	16.36%	NA
Indica I	595	97.00%	0.00%	1.68%	1.34%	NA
Indica II	465	97.80%	0.20%	1.51%	0.43%	NA
Indica III	913	99.60%	0.00%	0.22%	0.22%	NA
Indica Intermediate	786	92.60%	0.00%	1.40%	5.98%	NA
Temperate Japonica	767	53.10%	10.30%	9.26%	27.38%	NA
Tropical Japonica	504	73.60%	0.00%	6.35%	20.04%	NA
Japonica Intermediate	241	48.50%	8.70%	11.62%	31.12%	NA
VI/Aromatic	96	35.40%	0.00%	30.21%	34.38%	NA
Intermediate	90	81.10%	1.10%	5.56%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0325696417	C -> T	LOC_Os03g45519.1	upstream_gene_variant ; 2710.0bp to feature; MODIFIER	silent_mutation	Average:42.412; most accessible tissue: Minghui63 young leaf, score: 63.571	N	N	N	N
vg0325696417	C -> T	LOC_Os03g45528.1	upstream_gene_variant ; 1368.0bp to feature; MODIFIER	silent_mutation	Average:42.412; most accessible tissue: Minghui63 young leaf, score: 63.571	N	N	N	N
vg0325696417	C -> T	LOC_Os03g45550.1	upstream_gene_variant ; 3227.0bp to feature; MODIFIER	silent_mutation	Average:42.412; most accessible tissue: Minghui63 young leaf, score: 63.571	N	N	N	N
vg0325696417	C -> T	LOC_Os03g45540.1	downstream_gene_variant ; 456.0bp to feature; MODIFIER	silent_mutation	Average:42.412; most accessible tissue: Minghui63 young leaf, score: 63.571	N	N	N	N
vg0325696417	C -> T	LOC_Os03g45528-LOC_Os03g45540	intergenic_region ; MODIFIER	silent_mutation	Average:42.412; most accessible tissue: Minghui63 young leaf, score: 63.571	N	N	N	N
vg0325696417	C -> DEL	N	N	silent_mutation	Average:42.412; most accessible tissue: Minghui63 young leaf, score: 63.571	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0325696417	8.13E-13	8.13E-13	mr1166	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325696417	8.09E-33	3.67E-39	mr1210	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325696417	3.09E-06	NA	mr1252	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325696417	NA	9.31E-06	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325696417	1.72E-32	6.66E-38	mr1305	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325696417	NA	3.34E-06	mr1358	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325696417	1.73E-10	1.23E-11	mr1379	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325696417	6.75E-18	6.76E-18	mr1409	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325696417	7.03E-10	1.57E-13	mr1515	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325696417	7.54E-13	4.52E-11	mr1559	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325696417	1.16E-33	2.66E-42	mr1585	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325696417	4.79E-36	3.26E-42	mr1586	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325696417	3.74E-10	3.74E-10	mr1649	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325696417	8.90E-07	8.90E-07	mr1703	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325696417	2.01E-19	5.22E-23	mr1765	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325696417	3.84E-06	1.77E-07	mr1793	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325696417	4.03E-09	4.03E-09	mr1166_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325696417	5.95E-33	5.28E-37	mr1305_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325696417	1.19E-10	2.14E-08	mr1379_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325696417	4.03E-14	8.53E-16	mr1409_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325696417	2.86E-14	8.05E-14	mr1559_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325696417	2.97E-40	3.15E-49	mr1585_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325696417	8.02E-08	8.02E-08	mr1649_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325696417	2.69E-11	4.29E-13	mr1703_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325696417	6.69E-08	8.00E-11	mr1765_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325696417	2.15E-09	5.93E-12	mr1793_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251