Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0324795678:

Variant ID: vg0324795678 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 24795678
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAATATGCTATCCTGATTTCTGTCCCCCTGAAATTTCAGCCTGTAGCCATTGACCCCACGAATTAACCAAAGACCAGATCGAATCAGTCGTGTAGAACTC[G/A]
AGTGAGAGCAAGTATAACAGTGAGATGTAACCTTACTATAATCTTACGTGGAGGAGAGAGGTAATAAAAAAAAATCAAAGGTGTTGTCTTTCATGCAAGA

Reverse complement sequence

TCTTGCATGAAAGACAACACCTTTGATTTTTTTTTATTACCTCTCTCCTCCACGTAAGATTATAGTAAGGTTACATCTCACTGTTATACTTGCTCTCACT[C/T]
GAGTTCTACACGACTGATTCGATCTGGTCTTTGGTTAATTCGTGGGGTCAATGGCTACAGGCTGAAATTTCAGGGGGACAGAAATCAGGATAGCATATTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.90% 4.20% 10.22% 35.65% NA
All Indica  2759 31.50% 1.40% 12.25% 54.84% NA
All Japonica  1512 85.80% 10.50% 3.24% 0.46% NA
Aus  269 18.60% 0.00% 31.23% 50.19% NA
Indica I  595 68.40% 1.30% 6.72% 23.53% NA
Indica II  465 9.00% 0.60% 5.81% 84.52% NA
Indica III  913 14.90% 0.00% 19.61% 65.50% NA
Indica Intermediate  786 36.00% 3.70% 11.70% 48.60% NA
Temperate Japonica  767 76.70% 18.40% 4.43% 0.52% NA
Tropical Japonica  504 98.20% 0.00% 1.39% 0.40% NA
Japonica Intermediate  241 88.80% 7.50% 3.32% 0.41% NA
VI/Aromatic  96 88.50% 0.00% 5.21% 6.25% NA
Intermediate  90 64.40% 1.10% 7.78% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0324795678 G -> A LOC_Os03g44130.1 upstream_gene_variant ; 1161.0bp to feature; MODIFIER silent_mutation Average:51.083; most accessible tissue: Callus, score: 95.259 N N N N
vg0324795678 G -> A LOC_Os03g44140.1 downstream_gene_variant ; 2126.0bp to feature; MODIFIER silent_mutation Average:51.083; most accessible tissue: Callus, score: 95.259 N N N N
vg0324795678 G -> A LOC_Os03g44130-LOC_Os03g44140 intergenic_region ; MODIFIER silent_mutation Average:51.083; most accessible tissue: Callus, score: 95.259 N N N N
vg0324795678 G -> DEL N N silent_mutation Average:51.083; most accessible tissue: Callus, score: 95.259 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0324795678 2.84E-11 NA mr1210 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324795678 2.70E-06 1.62E-09 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324795678 3.77E-10 NA mr1305 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324795678 NA 4.66E-08 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324795678 3.26E-06 NA mr1379 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324795678 1.30E-06 NA mr1409 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324795678 5.11E-06 5.11E-06 mr1409 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324795678 6.08E-06 NA mr1515 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324795678 5.66E-09 7.86E-09 mr1585 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324795678 5.18E-06 7.38E-10 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324795678 4.61E-15 NA mr1586 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324795678 4.37E-07 1.85E-10 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324795678 1.98E-09 NA mr1765 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324795678 NA 8.17E-07 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324795678 1.33E-08 NA mr1305_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324795678 2.77E-06 1.43E-08 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324795678 4.03E-06 NA mr1379_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324795678 5.08E-07 1.88E-06 mr1559_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324795678 6.85E-06 6.95E-06 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324795678 5.63E-09 1.78E-08 mr1585_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324795678 4.11E-06 4.73E-10 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251