\
| Variant ID: vg0324008479 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 24008479 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.05, others allele: 0.00, population size: 99. )
TTTATCTTTCAACTACTGATGCGTTTTTTTAATCATTTTTGCTCTACTGCAACAAGCACCCAAAAGACTATCTTCTTGCAAAACACTAAAAATATATCAA[G/A]
CAAGAAAGAAGAGATACTCATGACACATGCTATACGTTGTCCAGATCGTTAAACTATAGAAAGGACACAATCTTCACTCAGAGATTCAATTGAAAGTTTT
AAAACTTTCAATTGAATCTCTGAGTGAAGATTGTGTCCTTTCTATAGTTTAACGATCTGGACAACGTATAGCATGTGTCATGAGTATCTCTTCTTTCTTG[C/T]
TTGATATATTTTTAGTGTTTTGCAAGAAGATAGTCTTTTGGGTGCTTGTTGCAGTAGAGCAAAAATGATTAAAAAAACGCATCAGTAGTTGAAAGATAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.70% | 5.30% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 92.80% | 7.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 81.40% | 18.20% | 0.37% | 0.00% | NA |
| Indica I | 595 | 77.80% | 22.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 93.10% | 6.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0324008479 | G -> A | LOC_Os03g43040.1 | upstream_gene_variant ; 1896.0bp to feature; MODIFIER | silent_mutation | Average:46.9; most accessible tissue: Zhenshan97 flower, score: 68.001 | N | N | N | N |
| vg0324008479 | G -> A | LOC_Os03g43030.1 | downstream_gene_variant ; 748.0bp to feature; MODIFIER | silent_mutation | Average:46.9; most accessible tissue: Zhenshan97 flower, score: 68.001 | N | N | N | N |
| vg0324008479 | G -> A | LOC_Os03g43020-LOC_Os03g43030 | intergenic_region ; MODIFIER | silent_mutation | Average:46.9; most accessible tissue: Zhenshan97 flower, score: 68.001 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0324008479 | NA | 3.24E-07 | Spikelet_length | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0324008479 | NA | 4.82E-06 | mr1418 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324008479 | NA | 4.35E-06 | mr1467 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324008479 | 2.12E-06 | 2.12E-06 | mr1681 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324008479 | NA | 8.75E-08 | mr1779 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324008479 | NA | 1.39E-07 | mr1816 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |