\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0324008479:

Variant ID: vg0324008479 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 24008479
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.05, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TTTATCTTTCAACTACTGATGCGTTTTTTTAATCATTTTTGCTCTACTGCAACAAGCACCCAAAAGACTATCTTCTTGCAAAACACTAAAAATATATCAA[G/A]
CAAGAAAGAAGAGATACTCATGACACATGCTATACGTTGTCCAGATCGTTAAACTATAGAAAGGACACAATCTTCACTCAGAGATTCAATTGAAAGTTTT

Reverse complement sequence

AAAACTTTCAATTGAATCTCTGAGTGAAGATTGTGTCCTTTCTATAGTTTAACGATCTGGACAACGTATAGCATGTGTCATGAGTATCTCTTCTTTCTTG[C/T]
TTGATATATTTTTAGTGTTTTGCAAGAAGATAGTCTTTTGGGTGCTTGTTGCAGTAGAGCAAAAATGATTAAAAAAACGCATCAGTAGTTGAAAGATAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.70% 5.30% 0.02% 0.00% NA
All Indica  2759 92.80% 7.20% 0.00% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 81.40% 18.20% 0.37% 0.00% NA
Indica I  595 77.80% 22.20% 0.00% 0.00% NA
Indica II  465 97.80% 2.20% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 93.10% 6.90% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0324008479 G -> A LOC_Os03g43040.1 upstream_gene_variant ; 1896.0bp to feature; MODIFIER silent_mutation Average:46.9; most accessible tissue: Zhenshan97 flower, score: 68.001 N N N N
vg0324008479 G -> A LOC_Os03g43030.1 downstream_gene_variant ; 748.0bp to feature; MODIFIER silent_mutation Average:46.9; most accessible tissue: Zhenshan97 flower, score: 68.001 N N N N
vg0324008479 G -> A LOC_Os03g43020-LOC_Os03g43030 intergenic_region ; MODIFIER silent_mutation Average:46.9; most accessible tissue: Zhenshan97 flower, score: 68.001 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0324008479 NA 3.24E-07 Spikelet_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0324008479 NA 4.82E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324008479 NA 4.35E-06 mr1467 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324008479 2.12E-06 2.12E-06 mr1681 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324008479 NA 8.75E-08 mr1779 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324008479 NA 1.39E-07 mr1816 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251