\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0323854038:

Variant ID: vg0323854038 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 23854038
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


GGCTTGTTTTGCAAATGAGATTATGAACTAAAGGGTAAGGTTCAATAATATCCATCCATTATTTTTATTGGGCTTCCCCTAATACATGAGTGATCGTGCA[C/T]
ATCAAGATACGTGATTAGGAAACGACAAAAAACAGCCCACCCTAGCCTATGTCACTGGCCTAACTCATATGCTCTCTCTTTCTCTTTTCCTATCCTCTTC

Reverse complement sequence

GAAGAGGATAGGAAAAGAGAAAGAGAGAGCATATGAGTTAGGCCAGTGACATAGGCTAGGGTGGGCTGTTTTTTGTCGTTTCCTAATCACGTATCTTGAT[G/A]
TGCACGATCACTCATGTATTAGGGGAAGCCCAATAAAAATAATGGATGGATATTATTGAACCTTACCCTTTAGTTCATAATCTCATTTGCAAAACAAGCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.90% 19.00% 0.02% 0.08% NA
All Indica  2759 76.90% 22.90% 0.04% 0.14% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 5.60% 94.40% 0.00% 0.00% NA
Indica I  595 66.70% 33.30% 0.00% 0.00% NA
Indica II  465 82.40% 16.80% 0.00% 0.86% NA
Indica III  913 78.90% 21.00% 0.11% 0.00% NA
Indica Intermediate  786 79.30% 20.70% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0323854038 C -> T LOC_Os03g42820.1 upstream_gene_variant ; 1149.0bp to feature; MODIFIER silent_mutation Average:82.007; most accessible tissue: Zhenshan97 flower, score: 96.955 N N N N
vg0323854038 C -> T LOC_Os03g42820.2 upstream_gene_variant ; 1106.0bp to feature; MODIFIER silent_mutation Average:82.007; most accessible tissue: Zhenshan97 flower, score: 96.955 N N N N
vg0323854038 C -> T LOC_Os03g42820.4 upstream_gene_variant ; 1149.0bp to feature; MODIFIER silent_mutation Average:82.007; most accessible tissue: Zhenshan97 flower, score: 96.955 N N N N
vg0323854038 C -> T LOC_Os03g42820.3 upstream_gene_variant ; 1213.0bp to feature; MODIFIER silent_mutation Average:82.007; most accessible tissue: Zhenshan97 flower, score: 96.955 N N N N
vg0323854038 C -> T LOC_Os03g42810.1 downstream_gene_variant ; 1850.0bp to feature; MODIFIER silent_mutation Average:82.007; most accessible tissue: Zhenshan97 flower, score: 96.955 N N N N
vg0323854038 C -> T LOC_Os03g42810.2 downstream_gene_variant ; 1947.0bp to feature; MODIFIER silent_mutation Average:82.007; most accessible tissue: Zhenshan97 flower, score: 96.955 N N N N
vg0323854038 C -> T LOC_Os03g42810-LOC_Os03g42820 intergenic_region ; MODIFIER silent_mutation Average:82.007; most accessible tissue: Zhenshan97 flower, score: 96.955 N N N N
vg0323854038 C -> DEL N N silent_mutation Average:82.007; most accessible tissue: Zhenshan97 flower, score: 96.955 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0323854038 C T -0.08 -0.06 -0.04 -0.06 -0.06 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0323854038 NA 1.93E-06 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323854038 NA 4.62E-06 mr1184 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323854038 NA 3.24E-06 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323854038 NA 7.18E-11 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323854038 NA 8.67E-07 mr1284 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323854038 NA 1.50E-08 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323854038 NA 3.16E-13 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323854038 NA 3.93E-07 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323854038 NA 1.90E-06 mr1374 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323854038 NA 5.79E-14 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323854038 NA 4.72E-06 mr1408 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323854038 NA 1.76E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323854038 NA 5.58E-10 mr1420 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323854038 NA 1.36E-09 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323854038 NA 6.72E-08 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323854038 NA 9.92E-06 mr1467 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323854038 NA 4.72E-09 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323854038 NA 1.67E-07 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323854038 NA 8.68E-07 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323854038 NA 7.39E-16 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323854038 NA 1.87E-06 mr1653 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323854038 NA 1.64E-10 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323854038 NA 5.11E-07 mr1685 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323854038 NA 8.69E-07 mr1735 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323854038 NA 2.74E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323854038 NA 6.73E-07 mr1816 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323854038 NA 8.94E-06 mr1816 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323854038 NA 7.01E-11 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323854038 NA 1.07E-06 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323854038 NA 5.18E-06 mr1898 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323854038 NA 1.79E-15 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323854038 NA 6.60E-11 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323854038 NA 8.96E-06 mr1968 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323854038 NA 1.26E-14 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323854038 NA 4.29E-07 mr1968_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251