Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0323736025:

Variant ID: vg0323736025 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 23736025
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, G: 0.01, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


TCGGGCGAGCTCTGCCATGGCGGCGGCGGCGGAGACGGTTTCGGCGCGCACAGGCTTCATGTCGGCGCGTACATGAGCTGGCTGCAGGCGGCGGCGGCGG[C/G]
CAACCAGGGCATGTTCCAGTGGCCGGCGGCCACGCAGGCGGGGCTGGTCGGAGGCACCGTGTTCGCGGCGGCGCACAAGGCGGCGGGGACGATGCCGTTC

Reverse complement sequence

GAACGGCATCGTCCCCGCCGCCTTGTGCGCCGCCGCGAACACGGTGCCTCCGACCAGCCCCGCCTGCGTGGCCGCCGGCCACTGGAACATGCCCTGGTTG[G/C]
CCGCCGCCGCCGCCTGCAGCCAGCTCATGTACGCGCCGACATGAAGCCTGTGCGCGCCGAAACCGTCTCCGCCGCCGCCGCCATGGCAGAGCTCGCCCGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.30% 33.40% 0.28% 0.00% NA
All Indica  2759 45.70% 53.90% 0.47% 0.00% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 78.40% 21.60% 0.00% 0.00% NA
Indica I  595 74.60% 24.70% 0.67% 0.00% NA
Indica II  465 14.20% 85.80% 0.00% 0.00% NA
Indica III  913 45.20% 54.70% 0.11% 0.00% NA
Indica Intermediate  786 42.90% 56.10% 1.02% 0.00% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 73.30% 26.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0323736025 C -> G LOC_Os03g42630.1 missense_variant ; p.Ala235Gly; MODERATE nonsynonymous_codon ; A235G Average:83.372; most accessible tissue: Zhenshan97 young leaf, score: 90.728 unknown unknown DELETERIOUS 0.01

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0323736025 C G -0.02 -0.01 -0.01 -0.01 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0323736025 NA 1.24E-07 Spikelet_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652