Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0323177575:

Variant ID: vg0323177575 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 23177575
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCCTCAGCCCATCGGGACAGTCGAGTCACCATCGGGTTGTAGCAGCAAGGTGTATCCTAGACTTTGTAGACATAGTTGCTCTCCTCCCGAAACGGATGGT[A/G]
AGCAAAGTCGGTACTTGCCAACTCAGCTCGGTGAATAGAGCTACGTCGGAGGAAGGCCTCCCGGGCTGCGTCCTGCATCGCGGTCTCTGTAAGTCGCGAC

Reverse complement sequence

GTCGCGACTTACAGAGACCGCGATGCAGGACGCAGCCCGGGAGGCCTTCCTCCGACGTAGCTCTATTCACCGAGCTGAGTTGGCAAGTACCGACTTTGCT[T/C]
ACCATCCGTTTCGGGAGGAGAGCAACTATGTCTACAAAGTCTAGGATACACCTTGCTGCTACAACCCGATGGTGACTCGACTGTCCCGATGGGCTGAGGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.90%	27.70%	4.21%	1.23%	NA
All Indica	2759	93.00%	1.30%	3.73%	2.03%	NA
All Japonica	1512	15.50%	78.70%	5.75%	0.00%	NA
Aus	269	98.10%	1.10%	0.74%	0.00%	NA
Indica I	595	96.30%	1.30%	1.68%	0.67%	NA
Indica II	465	97.80%	0.20%	1.08%	0.86%	NA
Indica III	913	91.00%	0.40%	5.59%	2.96%	NA
Indica Intermediate	786	89.80%	2.80%	4.71%	2.67%	NA
Temperate Japonica	767	20.10%	70.70%	9.26%	0.00%	NA
Tropical Japonica	504	6.20%	93.30%	0.60%	0.00%	NA
Japonica Intermediate	241	20.70%	73.90%	5.39%	0.00%	NA
VI/Aromatic	96	52.10%	47.90%	0.00%	0.00%	NA
Intermediate	90	51.10%	38.90%	7.78%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0323177575	A -> DEL	N	N	silent_mutation	Average:59.303; most accessible tissue: Minghui63 young leaf, score: 78.054	N	N	N	N
vg0323177575	A -> G	LOC_Os03g41710.1	upstream_gene_variant ; 1260.0bp to feature; MODIFIER	silent_mutation	Average:59.303; most accessible tissue: Minghui63 young leaf, score: 78.054	N	N	N	N
vg0323177575	A -> G	LOC_Os03g41720.1	upstream_gene_variant ; 69.0bp to feature; MODIFIER	silent_mutation	Average:59.303; most accessible tissue: Minghui63 young leaf, score: 78.054	N	N	N	N
vg0323177575	A -> G	LOC_Os03g41720-LOC_Os03g41740	intergenic_region ; MODIFIER	silent_mutation	Average:59.303; most accessible tissue: Minghui63 young leaf, score: 78.054	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0323177575	NA	2.20E-15	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323177575	NA	6.03E-07	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323177575	3.99E-06	NA	mr1305	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323177575	NA	1.11E-07	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323177575	NA	1.34E-10	mr1336	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323177575	NA	2.82E-08	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323177575	4.91E-06	NA	mr1586	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323177575	NA	1.65E-07	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323177575	NA	6.87E-14	mr1701	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323177575	6.37E-08	NA	mr1765	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323177575	2.77E-06	1.52E-10	mr1765	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323177575	NA	6.94E-18	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323177575	3.60E-06	NA	mr1305_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323177575	7.45E-06	8.05E-08	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323177575	NA	5.46E-20	mr1336_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323177575	2.27E-06	NA	mr1585_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323177575	NA	3.23E-08	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323177575	NA	1.53E-07	mr1749_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323177575	NA	6.06E-06	mr1793_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323177575	NA	1.77E-07	mr1821_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251