\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0323177575:

Variant ID: vg0323177575 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 23177575
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCCTCAGCCCATCGGGACAGTCGAGTCACCATCGGGTTGTAGCAGCAAGGTGTATCCTAGACTTTGTAGACATAGTTGCTCTCCTCCCGAAACGGATGGT[A/G]
AGCAAAGTCGGTACTTGCCAACTCAGCTCGGTGAATAGAGCTACGTCGGAGGAAGGCCTCCCGGGCTGCGTCCTGCATCGCGGTCTCTGTAAGTCGCGAC

Reverse complement sequence

GTCGCGACTTACAGAGACCGCGATGCAGGACGCAGCCCGGGAGGCCTTCCTCCGACGTAGCTCTATTCACCGAGCTGAGTTGGCAAGTACCGACTTTGCT[T/C]
ACCATCCGTTTCGGGAGGAGAGCAACTATGTCTACAAAGTCTAGGATACACCTTGCTGCTACAACCCGATGGTGACTCGACTGTCCCGATGGGCTGAGGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.90% 27.70% 4.21% 1.23% NA
All Indica  2759 93.00% 1.30% 3.73% 2.03% NA
All Japonica  1512 15.50% 78.70% 5.75% 0.00% NA
Aus  269 98.10% 1.10% 0.74% 0.00% NA
Indica I  595 96.30% 1.30% 1.68% 0.67% NA
Indica II  465 97.80% 0.20% 1.08% 0.86% NA
Indica III  913 91.00% 0.40% 5.59% 2.96% NA
Indica Intermediate  786 89.80% 2.80% 4.71% 2.67% NA
Temperate Japonica  767 20.10% 70.70% 9.26% 0.00% NA
Tropical Japonica  504 6.20% 93.30% 0.60% 0.00% NA
Japonica Intermediate  241 20.70% 73.90% 5.39% 0.00% NA
VI/Aromatic  96 52.10% 47.90% 0.00% 0.00% NA
Intermediate  90 51.10% 38.90% 7.78% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0323177575 A -> DEL N N silent_mutation Average:59.303; most accessible tissue: Minghui63 young leaf, score: 78.054 N N N N
vg0323177575 A -> G LOC_Os03g41710.1 upstream_gene_variant ; 1260.0bp to feature; MODIFIER silent_mutation Average:59.303; most accessible tissue: Minghui63 young leaf, score: 78.054 N N N N
vg0323177575 A -> G LOC_Os03g41720.1 upstream_gene_variant ; 69.0bp to feature; MODIFIER silent_mutation Average:59.303; most accessible tissue: Minghui63 young leaf, score: 78.054 N N N N
vg0323177575 A -> G LOC_Os03g41720-LOC_Os03g41740 intergenic_region ; MODIFIER silent_mutation Average:59.303; most accessible tissue: Minghui63 young leaf, score: 78.054 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0323177575 NA 2.20E-15 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323177575 NA 6.03E-07 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323177575 3.99E-06 NA mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323177575 NA 1.11E-07 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323177575 NA 1.34E-10 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323177575 NA 2.82E-08 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323177575 4.91E-06 NA mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323177575 NA 1.65E-07 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323177575 NA 6.87E-14 mr1701 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323177575 6.37E-08 NA mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323177575 2.77E-06 1.52E-10 mr1765 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323177575 NA 6.94E-18 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323177575 3.60E-06 NA mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323177575 7.45E-06 8.05E-08 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323177575 NA 5.46E-20 mr1336_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323177575 2.27E-06 NA mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323177575 NA 3.23E-08 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323177575 NA 1.53E-07 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323177575 NA 6.06E-06 mr1793_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323177575 NA 1.77E-07 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251