Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0322388599:

Variant ID: vg0322388599 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 22388599
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAATGAATCCATAATCCATCGAGGTTATCGATCACATTAGGATTGTGTTCTCCCCCTTCTTTCCCAACTCATCTCCCTCTTTTTACGCACACATGCTTTT[T/C]
AAACGGCTAAACGGTACATTTTTTAATGTTTTATATAGAAAAGTTACTTTAAAAATAATATTAATCTATTTCTCATTTTTTTTAATACTTAATTAATAAC

Reverse complement sequence

GTTATTAATTAAGTATTAAAAAAAATGAGAAATAGATTAATATTATTTTTAAAGTAACTTTTCTATATAAAACATTAAAAAATGTACCGTTTAGCCGTTT[A/G]
AAAAGCATGTGTGCGTAAAAAGAGGGAGATGAGTTGGGAAAGAAGGGGGAGAACACAATCCTAATGTGATCGATAACCTCGATGGATTATGGATTCATTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.70% 26.50% 0.80% 0.00% NA
All Indica  2759 98.40% 1.60% 0.00% 0.00% NA
All Japonica  1512 22.20% 75.30% 2.45% 0.00% NA
Aus  269 95.50% 4.50% 0.00% 0.00% NA
Indica I  595 98.80% 1.20% 0.00% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 97.60% 2.40% 0.00% 0.00% NA
Temperate Japonica  767 22.30% 73.80% 3.91% 0.00% NA
Tropical Japonica  504 14.90% 84.70% 0.40% 0.00% NA
Japonica Intermediate  241 37.30% 60.60% 2.07% 0.00% NA
VI/Aromatic  96 76.00% 24.00% 0.00% 0.00% NA
Intermediate  90 61.10% 37.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0322388599 T -> C LOC_Os03g40270.1 upstream_gene_variant ; 4666.0bp to feature; MODIFIER silent_mutation Average:69.088; most accessible tissue: Zhenshan97 flower, score: 94.192 N N N N
vg0322388599 T -> C LOC_Os03g40270-LOC_Os03g40290 intergenic_region ; MODIFIER silent_mutation Average:69.088; most accessible tissue: Zhenshan97 flower, score: 94.192 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0322388599 T C -0.03 -0.01 -0.01 -0.01 -0.02 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0322388599 NA 1.58E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322388599 NA 5.58E-06 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322388599 NA 6.16E-08 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322388599 NA 1.11E-07 mr1881 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322388599 1.00E-06 1.00E-06 mr1881 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322388599 NA 5.77E-11 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322388599 NA 9.49E-06 mr1992 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251