\
| Variant ID: vg0321323667 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 21323667 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AATAAGGGTTGGTCTTGCCCTCTACAGGCCCTTCTCCACGCCCAACTCGGGATAGAAACCAAAGGAAACACGAAACATGCCTTCTCGAGCAATGAAACCC[G/A]
AGACCCGACGACAATAGACTCTGACTCGGACCCTGCCGGTCTGACCGCCCACATACTTGAGGTCAGACCGGCCCTACTAGCCGGTCAGACCGCCCACACA
TGTGTGGGCGGTCTGACCGGCTAGTAGGGCCGGTCTGACCTCAAGTATGTGGGCGGTCAGACCGGCAGGGTCCGAGTCAGAGTCTATTGTCGTCGGGTCT[C/T]
GGGTTTCATTGCTCGAGAAGGCATGTTTCGTGTTTCCTTTGGTTTCTATCCCGAGTTGGGCGTGGAGAAGGGCCTGTAGAGGGCAAGACCAACCCTTATT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.60% | 33.70% | 0.40% | 5.27% | NA |
| All Indica | 2759 | 95.20% | 3.70% | 0.36% | 0.69% | NA |
| All Japonica | 1512 | 7.50% | 91.60% | 0.00% | 0.93% | NA |
| Aus | 269 | 1.50% | 16.40% | 3.35% | 78.81% | NA |
| Indica I | 595 | 94.60% | 5.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.20% | 2.60% | 0.22% | 0.00% | NA |
| Indica III | 913 | 96.70% | 2.20% | 0.77% | 0.33% | NA |
| Indica Intermediate | 786 | 92.70% | 5.00% | 0.25% | 2.04% | NA |
| Temperate Japonica | 767 | 0.50% | 99.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 6.20% | 91.10% | 0.00% | 2.78% | NA |
| Japonica Intermediate | 241 | 32.40% | 67.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 76.00% | 22.90% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 53.30% | 43.30% | 0.00% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0321323667 | G -> A | LOC_Os03g38410.1 | upstream_gene_variant ; 1343.0bp to feature; MODIFIER | silent_mutation | Average:56.158; most accessible tissue: Minghui63 flag leaf, score: 73.752 | N | N | N | N |
| vg0321323667 | G -> A | LOC_Os03g38410-LOC_Os03g38430 | intergenic_region ; MODIFIER | silent_mutation | Average:56.158; most accessible tissue: Minghui63 flag leaf, score: 73.752 | N | N | N | N |
| vg0321323667 | G -> DEL | N | N | silent_mutation | Average:56.158; most accessible tissue: Minghui63 flag leaf, score: 73.752 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0321323667 | NA | 4.36E-08 | mr1666 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321323667 | NA | 1.01E-06 | mr1761 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321323667 | NA | 1.41E-28 | mr1793 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321323667 | NA | 2.45E-37 | mr1828 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321323667 | NA | 2.67E-06 | mr1020_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321323667 | NA | 3.00E-31 | mr1102_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321323667 | NA | 2.27E-09 | mr1198_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321323667 | NA | 6.16E-10 | mr1349_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321323667 | NA | 3.73E-24 | mr1350_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321323667 | NA | 1.23E-15 | mr1666_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321323667 | NA | 2.11E-19 | mr1731_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321323667 | 7.93E-07 | NA | mr1750_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321323667 | NA | 2.43E-12 | mr1761_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321323667 | NA | 7.32E-20 | mr1922_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0321323667 | NA | 9.70E-22 | mr1924_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |