Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0321275600:

Variant ID: vg0321275600 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 21275600
Reference Allele: C	Alternative Allele: G
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTATATAGTAGTATATTTCTATGGCTGTACTTGAAGCTTGAAAAAAGTGGAATCTCACAAGCAGCTCGATCGATCAGTACACCGTGAAGATGAGATGAAG[C/G]
CTACATAGCAGCGAGCTGCCTAATGTTCACGGGGAAGACGAGCGGCGGCGAGCCGTCGAACGCGACGGCGGTGAGCATCCGCGCGGTGGCCTCGGTCGGG

Reverse complement sequence

CCCGACCGAGGCCACCGCGCGGATGCTCACCGCCGTCGCGTTCGACGGCTCGCCGCCGCTCGTCTTCCCCGTGAACATTAGGCAGCTCGCTGCTATGTAG[G/C]
CTTCATCTCATCTTCACGGTGTACTGATCGATCGAGCTGCTTGTGAGATTCCACTTTTTTCAAGCTTCAAGTACAGCCATAGAAATATACTACTATATAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.30%	35.60%	0.06%	0.02%	NA
All Indica	2759	97.80%	2.20%	0.00%	0.00%	NA
All Japonica	1512	1.70%	98.20%	0.07%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	98.70%	1.30%	0.00%	0.00%	NA
Indica II	465	97.40%	2.60%	0.00%	0.00%	NA
Indica III	913	98.20%	1.80%	0.00%	0.00%	NA
Indica Intermediate	786	96.70%	3.30%	0.00%	0.00%	NA
Temperate Japonica	767	0.30%	99.70%	0.00%	0.00%	NA
Tropical Japonica	504	4.40%	95.40%	0.20%	0.00%	NA
Japonica Intermediate	241	0.80%	99.20%	0.00%	0.00%	NA
VI/Aromatic	96	4.20%	94.80%	1.04%	0.00%	NA
Intermediate	90	48.90%	48.90%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0321275600	C -> DEL	N	N	silent_mutation	Average:85.46; most accessible tissue: Zhenshan97 flag leaf, score: 94.613	N	N	N	N
vg0321275600	C -> G	LOC_Os03g38350.1	3_prime_UTR_variant ; 20.0bp to feature; MODIFIER	silent_mutation	Average:85.46; most accessible tissue: Zhenshan97 flag leaf, score: 94.613	N	N	N	N
vg0321275600	C -> G	LOC_Os03g38330.1	downstream_gene_variant ; 3188.0bp to feature; MODIFIER	silent_mutation	Average:85.46; most accessible tissue: Zhenshan97 flag leaf, score: 94.613	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0321275600	C	G	0.01	0.01	0.02	0.01	0.02	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0321275600	NA	2.98E-37	mr1670	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321275600	2.25E-13	9.24E-95	mr1718	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321275600	8.06E-22	9.29E-171	mr1750	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321275600	NA	4.01E-17	mr1842	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321275600	NA	1.04E-39	mr1873	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321275600	1.85E-06	2.58E-117	mr1987	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321275600	NA	1.76E-16	mr1342_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321275600	NA	3.68E-10	mr1595_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321275600	NA	3.86E-36	mr1689_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321275600	NA	1.38E-12	mr1713_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321275600	1.10E-17	1.72E-141	mr1718_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321275600	5.29E-30	5.60E-240	mr1750_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321275600	NA	1.37E-16	mr1842_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321275600	NA	7.80E-11	mr1893_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321275600	NA	6.12E-23	mr1933_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0321275600	6.21E-06	5.36E-158	mr1987_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251