\
| Variant ID: vg0319091716 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 19091716 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CATAAAGAATGGAAATATATTTTGCTCTGATAAACTCACATGGTTTTGAGCTACAATATATAAAATGTGCAATCATTTTGAGCCAAAAAATGGAGCATCA[A/T]
GAAGTGGGGCCCACATGTCAGCATCCTGAAGAAAGATGTGGGCCAGGGGAGCCAACCAGGGTGGTTCGGCCGAACCCCTAGCTGGCCCAGTCCAGCCCAT
ATGGGCTGGACTGGGCCAGCTAGGGGTTCGGCCGAACCACCCTGGTTGGCTCCCCTGGCCCACATCTTTCTTCAGGATGCTGACATGTGGGCCCCACTTC[T/A]
TGATGCTCCATTTTTTGGCTCAAAATGATTGCACATTTTATATATTGTAGCTCAAAACCATGTGAGTTTATCAGAGCAAAATATATTTCCATTCTTTATG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.10% | 32.60% | 0.53% | 13.73% | NA |
| All Indica | 2759 | 78.60% | 3.50% | 0.40% | 17.47% | NA |
| All Japonica | 1512 | 2.10% | 86.60% | 0.66% | 10.65% | NA |
| Aus | 269 | 90.30% | 9.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 92.90% | 2.50% | 0.50% | 4.03% | NA |
| Indica II | 465 | 74.40% | 4.50% | 0.22% | 20.86% | NA |
| Indica III | 913 | 69.40% | 1.50% | 0.44% | 28.59% | NA |
| Indica Intermediate | 786 | 80.90% | 6.00% | 0.38% | 12.72% | NA |
| Temperate Japonica | 767 | 0.30% | 99.60% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 5.20% | 65.90% | 0.60% | 28.37% | NA |
| Japonica Intermediate | 241 | 1.70% | 88.40% | 2.90% | 7.05% | NA |
| VI/Aromatic | 96 | 27.10% | 71.90% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 45.60% | 44.40% | 4.44% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0319091716 | A -> T | LOC_Os03g33380.1 | downstream_gene_variant ; 4073.0bp to feature; MODIFIER | silent_mutation | Average:24.881; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0319091716 | A -> T | LOC_Os03g33390.1 | downstream_gene_variant ; 1983.0bp to feature; MODIFIER | silent_mutation | Average:24.881; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0319091716 | A -> T | LOC_Os03g33384.1 | intron_variant ; MODIFIER | silent_mutation | Average:24.881; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0319091716 | A -> DEL | N | N | silent_mutation | Average:24.881; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0319091716 | NA | 5.70E-09 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319091716 | NA | 1.60E-10 | mr1188 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319091716 | NA | 3.59E-09 | mr1188 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319091716 | NA | 4.05E-08 | mr1718 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319091716 | 1.99E-06 | 1.43E-15 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319091716 | NA | 6.86E-15 | mr1933 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319091716 | 5.04E-06 | 5.03E-06 | mr1987 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319091716 | NA | 1.23E-07 | mr1004_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319091716 | NA | 1.56E-10 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319091716 | NA | 1.20E-13 | mr1217_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319091716 | 3.05E-06 | 1.19E-07 | mr1217_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319091716 | NA | 1.51E-22 | mr1386_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319091716 | 4.81E-06 | 2.93E-12 | mr1718_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319091716 | 1.17E-08 | 1.10E-151 | mr1750_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319091716 | 6.09E-11 | 4.12E-31 | mr1750_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319091716 | NA | 4.41E-09 | mr1987_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |