\
| Variant ID: vg0317301865 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 17301865 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.09, others allele: 0.00, population size: 213. )
CAAGCACTAGCAAATGCAAAGTATGAAAAGCACACTTTGTAATTGGATAACTGCCTATCACTTTTGTGATTTTGGAGAGCATGACTAAGTTGCATTACCC[G/A]
AATATAATGCACCGGAGGAGGGTGAAATACCGAAGAATGCAAAGGTATACCTCATATTGTCTAGAGGCCTCGAGAAAAATAATGGGACAAGAACTCCGGC
GCCGGAGTTCTTGTCCCATTATTTTTCTCGAGGCCTCTAGACAATATGAGGTATACCTTTGCATTCTTCGGTATTTCACCCTCCTCCGGTGCATTATATT[C/T]
GGGTAATGCAACTTAGTCATGCTCTCCAAAATCACAAAAGTGATAGGCAGTTATCCAATTACAAAGTGTGCTTTTCATACTTTGCATTTGCTAGTGCTTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.50% | 10.50% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 95.50% | 4.50% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 95.20% | 4.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 20.40% | 79.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 91.60% | 8.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 86.50% | 13.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 19.80% | 80.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 12.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0317301865 | G -> A | LOC_Os03g30334.1 | upstream_gene_variant ; 2451.0bp to feature; MODIFIER | silent_mutation | Average:42.414; most accessible tissue: Minghui63 flag leaf, score: 59.244 | N | N | N | N |
| vg0317301865 | G -> A | LOC_Os03g30320.1 | downstream_gene_variant ; 2395.0bp to feature; MODIFIER | silent_mutation | Average:42.414; most accessible tissue: Minghui63 flag leaf, score: 59.244 | N | N | N | N |
| vg0317301865 | G -> A | LOC_Os03g30320-LOC_Os03g30334 | intergenic_region ; MODIFIER | silent_mutation | Average:42.414; most accessible tissue: Minghui63 flag leaf, score: 59.244 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0317301865 | NA | 5.27E-06 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317301865 | NA | 1.75E-06 | mr1073 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317301865 | NA | 1.46E-08 | mr1153 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317301865 | NA | 3.32E-08 | mr1262 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317301865 | NA | 3.58E-08 | mr1403 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317301865 | NA | 1.90E-06 | mr1417 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317301865 | NA | 3.44E-08 | mr1465 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317301865 | NA | 4.15E-12 | mr1522 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317301865 | NA | 1.31E-11 | mr1612 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317301865 | NA | 2.02E-06 | mr1652 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317301865 | NA | 1.91E-07 | mr1989 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317301865 | NA | 8.10E-07 | mr1126_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317301865 | NA | 2.84E-08 | mr1612_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |