| Variant ID: vg0316454459 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 16454459 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TTATTAAAAAAATTTATTTAAGTAATTATTAATTCTTTTCCTATCATTTGATTCATTGCTAATTATATTTTTATGTAGGCATATAATTTTACATATTTCA[T/C]
AAAAATTTTTAATAAGACGAACGGTCAAATATGTGCTAAAAAGTCAACGGTGTCAAATAGTTTGAAATGGAGGGAGTATATAAAACTTGCTGTTATAGAT
ATCTATAACAGCAAGTTTTATATACTCCCTCCATTTCAAACTATTTGACACCGTTGACTTTTTAGCACATATTTGACCGTTCGTCTTATTAAAAATTTTT[A/G]
TGAAATATGTAAAATTATATGCCTACATAAAAATATAATTAGCAATGAATCAAATGATAGGAAAAGAATTAATAATTACTTAAATAAATTTTTTTAATAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.40% | 23.40% | 0.30% | 11.91% | NA |
| All Indica | 2759 | 82.30% | 14.70% | 0.22% | 2.83% | NA |
| All Japonica | 1512 | 41.60% | 30.80% | 0.40% | 27.25% | NA |
| Aus | 269 | 2.20% | 75.80% | 0.00% | 21.93% | NA |
| Indica I | 595 | 94.30% | 5.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.90% | 2.40% | 0.00% | 1.72% | NA |
| Indica III | 913 | 71.10% | 26.60% | 0.11% | 2.19% | NA |
| Indica Intermediate | 786 | 78.10% | 14.90% | 0.64% | 6.36% | NA |
| Temperate Japonica | 767 | 51.90% | 4.80% | 0.65% | 42.63% | NA |
| Tropical Japonica | 504 | 27.80% | 63.50% | 0.00% | 8.73% | NA |
| Japonica Intermediate | 241 | 37.80% | 44.80% | 0.41% | 17.01% | NA |
| VI/Aromatic | 96 | 85.40% | 10.40% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 61.10% | 25.60% | 2.22% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0316454459 | T -> C | LOC_Os03g28990.1 | upstream_gene_variant ; 3059.0bp to feature; MODIFIER | silent_mutation | Average:70.317; most accessible tissue: Callus, score: 98.849 | N | N | N | N |
| vg0316454459 | T -> C | LOC_Os03g28990.2 | upstream_gene_variant ; 3059.0bp to feature; MODIFIER | silent_mutation | Average:70.317; most accessible tissue: Callus, score: 98.849 | N | N | N | N |
| vg0316454459 | T -> C | LOC_Os03g28980.1 | downstream_gene_variant ; 2491.0bp to feature; MODIFIER | silent_mutation | Average:70.317; most accessible tissue: Callus, score: 98.849 | N | N | N | N |
| vg0316454459 | T -> C | LOC_Os03g28980-LOC_Os03g28990 | intergenic_region ; MODIFIER | silent_mutation | Average:70.317; most accessible tissue: Callus, score: 98.849 | N | N | N | N |
| vg0316454459 | T -> DEL | N | N | silent_mutation | Average:70.317; most accessible tissue: Callus, score: 98.849 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0316454459 | NA | 6.35E-10 | mr1345 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316454459 | NA | 1.29E-06 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316454459 | NA | 2.32E-06 | mr1401 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316454459 | NA | 2.23E-09 | mr1427 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316454459 | NA | 2.15E-07 | mr1634 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316454459 | NA | 2.68E-08 | mr1727 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316454459 | NA | 9.46E-07 | mr1756 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316454459 | NA | 9.13E-06 | mr1777 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316454459 | NA | 3.82E-06 | mr1546_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316454459 | NA | 1.80E-06 | mr1693_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316454459 | NA | 3.60E-08 | mr1808_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |