\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316345474:

Variant ID: vg0316345474 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 16345474
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGAGGGCCGAAGAAGCCTTTTCCGGCCCATCAAGCCTAGGGGCCATTGGGCCGACGATCGCCTAACGGCCCATCAGGGGTCCATGAACCTCTATTACAC[T/A]
ATGTACCCATGTAAATGTCCCTTTCATAAGGGTAACCATGTAAATTCTCCTGTATAACCAAAACTCTAGTAGTAAGAACCTGTAATAGGGGCTATAAATA

Reverse complement sequence

TATTTATAGCCCCTATTACAGGTTCTTACTACTAGAGTTTTGGTTATACAGGAGAATTTACATGGTTACCCTTATGAAAGGGACATTTACATGGGTACAT[A/T]
GTGTAATAGAGGTTCATGGACCCCTGATGGGCCGTTAGGCGATCGTCGGCCCAATGGCCCCTAGGCTTGATGGGCCGGAAAAGGCTTCTTCGGCCCTCAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.10% 5.90% 0.02% 0.00% NA
All Indica  2759 99.70% 0.30% 0.00% 0.00% NA
All Japonica  1512 82.50% 17.50% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.20% 0.80% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.30% 0.00% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 50.60% 49.40% 0.00% 0.00% NA
Japonica Intermediate  241 94.60% 5.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 6.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0316345474 T -> A LOC_Os03g28370.1 upstream_gene_variant ; 956.0bp to feature; MODIFIER silent_mutation Average:56.291; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 N N N N
vg0316345474 T -> A LOC_Os03g28360-LOC_Os03g28370 intergenic_region ; MODIFIER silent_mutation Average:56.291; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0316345474 4.11E-06 1.31E-08 mr1072_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316345474 1.09E-06 7.19E-09 mr1075_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316345474 5.66E-06 2.35E-09 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316345474 NA 8.52E-07 mr1220_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316345474 NA 1.30E-06 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316345474 NA 9.22E-07 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316345474 7.45E-06 NA mr1600_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316345474 NA 7.66E-06 mr1638_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316345474 NA 1.62E-06 mr1739_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316345474 NA 8.88E-06 mr1740_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316345474 NA 4.51E-06 mr1870_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316345474 NA 4.81E-06 mr1896_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251