Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315486151:

Variant ID: vg0315486151 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 15486151
Reference Allele: C	Alternative Allele: T,A
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.79, T: 0.18, A: 0.03, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:

TCATGTAAGCAAATAATCTCTGATCTCTATGTAGAATCGAACACAAGTAACCAAACCTACCAGAGGGGGGTGAATGGTAGGGAAAACAAAAACCCAAAAA[C/T,A]
TTTTAGCGAAAATAAAAGTTACCCTCAAATCGATGAAATCTCGATGTAGTCCTGTCGCCACCGGTCAGACCGCTCGCACGCTGCCGGTCGGACCGCTCGC

Reverse complement sequence

GCGAGCGGTCCGACCGGCAGCGTGCGAGCGGTCTGACCGGTGGCGACAGGACTACATCGAGATTTCATCGATTTGAGGGTAACTTTTATTTTCGCTAAAA[G/A,T]
TTTTTGGGTTTTTGTTTTCCCTACCATTCACCCCCCTCTGGTAGGTTTGGTTACTTGTGTTCGATTCTACATAGAGATCAGAGATTATTTGCTTACATGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.20%	44.60%	0.15%	0.00%	A: 0.06%
All Indica	2759	83.40%	16.40%	0.18%	0.00%	A: 0.07%
All Japonica	1512	15.80%	84.00%	0.13%	0.00%	A: 0.07%
Aus	269	5.20%	94.80%	0.00%	0.00%	NA
Indica I	595	93.90%	5.50%	0.50%	0.00%	NA
Indica II	465	89.70%	10.30%	0.00%	0.00%	NA
Indica III	913	72.90%	26.80%	0.00%	0.00%	A: 0.22%
Indica Intermediate	786	83.70%	16.00%	0.25%	0.00%	NA
Temperate Japonica	767	1.30%	98.70%	0.00%	0.00%	NA
Tropical Japonica	504	43.30%	56.50%	0.20%	0.00%	NA
Japonica Intermediate	241	4.60%	94.60%	0.41%	0.00%	A: 0.41%
VI/Aromatic	96	5.20%	94.80%	0.00%	0.00%	NA
Intermediate	90	56.70%	43.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0315486151	C -> T	LOC_Os03g27040.1	upstream_gene_variant ; 4012.0bp to feature; MODIFIER	silent_mutation	Average:63.981; most accessible tissue: Minghui63 panicle, score: 76.913	N	N	N	N
vg0315486151	C -> T	LOC_Os03g27054.1	upstream_gene_variant ; 895.0bp to feature; MODIFIER	silent_mutation	Average:63.981; most accessible tissue: Minghui63 panicle, score: 76.913	N	N	N	N
vg0315486151	C -> T	LOC_Os03g27050.1	downstream_gene_variant ; 2348.0bp to feature; MODIFIER	silent_mutation	Average:63.981; most accessible tissue: Minghui63 panicle, score: 76.913	N	N	N	N
vg0315486151	C -> T	LOC_Os03g27050-LOC_Os03g27054	intergenic_region ; MODIFIER	silent_mutation	Average:63.981; most accessible tissue: Minghui63 panicle, score: 76.913	N	N	N	N
vg0315486151	C -> A	LOC_Os03g27040.1	upstream_gene_variant ; 4012.0bp to feature; MODIFIER	silent_mutation	Average:63.981; most accessible tissue: Minghui63 panicle, score: 76.913	N	N	N	N
vg0315486151	C -> A	LOC_Os03g27054.1	upstream_gene_variant ; 895.0bp to feature; MODIFIER	silent_mutation	Average:63.981; most accessible tissue: Minghui63 panicle, score: 76.913	N	N	N	N
vg0315486151	C -> A	LOC_Os03g27050.1	downstream_gene_variant ; 2348.0bp to feature; MODIFIER	silent_mutation	Average:63.981; most accessible tissue: Minghui63 panicle, score: 76.913	N	N	N	N
vg0315486151	C -> A	LOC_Os03g27050-LOC_Os03g27054	intergenic_region ; MODIFIER	silent_mutation	Average:63.981; most accessible tissue: Minghui63 panicle, score: 76.913	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0315486151	NA	2.25E-07	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315486151	NA	2.90E-16	mr1147	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315486151	NA	2.18E-31	mr1224	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315486151	NA	8.51E-07	mr1354	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315486151	NA	1.91E-08	mr1929	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315486151	NA	1.59E-06	mr1138_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315486151	NA	1.71E-12	mr1147_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315486151	NA	1.06E-36	mr1224_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315486151	NA	7.38E-10	mr1322_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315486151	NA	3.11E-06	mr1322_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315486151	NA	1.35E-07	mr1324_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315486151	8.74E-07	1.90E-16	mr1325_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315486151	NA	8.70E-07	mr1325_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315486151	6.11E-08	1.01E-18	mr1326_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315486151	1.62E-06	1.27E-08	mr1326_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315486151	9.28E-06	8.66E-15	mr1333_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315486151	NA	4.42E-07	mr1333_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315486151	NA	7.53E-10	mr1338_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315486151	NA	1.17E-08	mr1354_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315486151	NA	1.61E-09	mr1690_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315486151	NA	9.40E-17	mr1744_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315486151	4.78E-06	4.78E-06	mr1755_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315486151	NA	2.86E-06	mr1925_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315486151	NA	5.33E-06	mr1929_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251