\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315486151:

Variant ID: vg0315486151 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 15486151
Reference Allele: CAlternative Allele: T,A
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.79, T: 0.18, A: 0.03, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


TCATGTAAGCAAATAATCTCTGATCTCTATGTAGAATCGAACACAAGTAACCAAACCTACCAGAGGGGGGTGAATGGTAGGGAAAACAAAAACCCAAAAA[C/T,A]
TTTTAGCGAAAATAAAAGTTACCCTCAAATCGATGAAATCTCGATGTAGTCCTGTCGCCACCGGTCAGACCGCTCGCACGCTGCCGGTCGGACCGCTCGC

Reverse complement sequence

GCGAGCGGTCCGACCGGCAGCGTGCGAGCGGTCTGACCGGTGGCGACAGGACTACATCGAGATTTCATCGATTTGAGGGTAACTTTTATTTTCGCTAAAA[G/A,T]
TTTTTGGGTTTTTGTTTTCCCTACCATTCACCCCCCTCTGGTAGGTTTGGTTACTTGTGTTCGATTCTACATAGAGATCAGAGATTATTTGCTTACATGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.20% 44.60% 0.15% 0.00% A: 0.06%
All Indica  2759 83.40% 16.40% 0.18% 0.00% A: 0.07%
All Japonica  1512 15.80% 84.00% 0.13% 0.00% A: 0.07%
Aus  269 5.20% 94.80% 0.00% 0.00% NA
Indica I  595 93.90% 5.50% 0.50% 0.00% NA
Indica II  465 89.70% 10.30% 0.00% 0.00% NA
Indica III  913 72.90% 26.80% 0.00% 0.00% A: 0.22%
Indica Intermediate  786 83.70% 16.00% 0.25% 0.00% NA
Temperate Japonica  767 1.30% 98.70% 0.00% 0.00% NA
Tropical Japonica  504 43.30% 56.50% 0.20% 0.00% NA
Japonica Intermediate  241 4.60% 94.60% 0.41% 0.00% A: 0.41%
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 56.70% 43.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0315486151 C -> T LOC_Os03g27040.1 upstream_gene_variant ; 4012.0bp to feature; MODIFIER silent_mutation Average:63.981; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0315486151 C -> T LOC_Os03g27054.1 upstream_gene_variant ; 895.0bp to feature; MODIFIER silent_mutation Average:63.981; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0315486151 C -> T LOC_Os03g27050.1 downstream_gene_variant ; 2348.0bp to feature; MODIFIER silent_mutation Average:63.981; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0315486151 C -> T LOC_Os03g27050-LOC_Os03g27054 intergenic_region ; MODIFIER silent_mutation Average:63.981; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0315486151 C -> A LOC_Os03g27040.1 upstream_gene_variant ; 4012.0bp to feature; MODIFIER silent_mutation Average:63.981; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0315486151 C -> A LOC_Os03g27054.1 upstream_gene_variant ; 895.0bp to feature; MODIFIER silent_mutation Average:63.981; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0315486151 C -> A LOC_Os03g27050.1 downstream_gene_variant ; 2348.0bp to feature; MODIFIER silent_mutation Average:63.981; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0315486151 C -> A LOC_Os03g27050-LOC_Os03g27054 intergenic_region ; MODIFIER silent_mutation Average:63.981; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0315486151 NA 2.25E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315486151 NA 2.90E-16 mr1147 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315486151 NA 2.18E-31 mr1224 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315486151 NA 8.51E-07 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315486151 NA 1.91E-08 mr1929 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315486151 NA 1.59E-06 mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315486151 NA 1.71E-12 mr1147_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315486151 NA 1.06E-36 mr1224_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315486151 NA 7.38E-10 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315486151 NA 3.11E-06 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315486151 NA 1.35E-07 mr1324_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315486151 8.74E-07 1.90E-16 mr1325_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315486151 NA 8.70E-07 mr1325_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315486151 6.11E-08 1.01E-18 mr1326_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315486151 1.62E-06 1.27E-08 mr1326_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315486151 9.28E-06 8.66E-15 mr1333_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315486151 NA 4.42E-07 mr1333_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315486151 NA 7.53E-10 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315486151 NA 1.17E-08 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315486151 NA 1.61E-09 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315486151 NA 9.40E-17 mr1744_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315486151 4.78E-06 4.78E-06 mr1755_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315486151 NA 2.86E-06 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315486151 NA 5.33E-06 mr1929_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251