\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315008270:

Variant ID: vg0315008270 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 15008270
Reference Allele: AAlternative Allele: G,C
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, G: 0.04, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


ATACTGTTGGGAATATTTGAAGTGTTGGGTACCTTGTCTTTTGAAAACTGGCTTTGATTATACTAAAGCGGATACTAAATCTGGCCTCAAAATTGTTCTA[A/G,C]
TAAATCTGGAATTCGAACTCGCAAATAATTTGTTGTCACGCAGGCATGTATATTCTAGGGATCTTTTGAGTTTGTTGGTGCATATGCGAAAAGTGGAAAC

Reverse complement sequence

GTTTCCACTTTTCGCATATGCACCAACAAACTCAAAAGATCCCTAGAATATACATGCCTGCGTGACAACAAATTATTTGCGAGTTCGAATTCCAGATTTA[T/C,G]
TAGAACAATTTTGAGGCCAGATTTAGTATCCGCTTTAGTATAATCAAAGCCAGTTTTCAAAAGACAAGGTACCCAACACTTCAAATATTCCCAACAGTAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.70% 22.90% 7.41% 10.77% C: 0.23%
All Indica  2759 71.20% 6.30% 6.92% 15.26% C: 0.25%
All Japonica  1512 43.70% 51.30% 4.23% 0.86% NA
Aus  269 3.00% 39.40% 31.97% 24.16% C: 1.49%
Indica I  595 46.40% 6.90% 13.11% 33.61% NA
Indica II  465 51.40% 12.70% 11.83% 24.09% NA
Indica III  913 89.50% 3.80% 2.96% 2.96% C: 0.77%
Indica Intermediate  786 80.50% 5.10% 3.94% 10.43% NA
Temperate Japonica  767 17.60% 76.40% 5.87% 0.13% NA
Tropical Japonica  504 65.10% 29.40% 3.57% 1.98% NA
Japonica Intermediate  241 81.70% 17.00% 0.41% 0.83% NA
VI/Aromatic  96 92.70% 5.20% 1.04% 1.04% NA
Intermediate  90 60.00% 21.10% 8.89% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0315008270 A -> C LOC_Os03g26220.1 upstream_gene_variant ; 3707.0bp to feature; MODIFIER silent_mutation Average:68.815; most accessible tissue: Callus, score: 91.518 N N N N
vg0315008270 A -> C LOC_Os03g26250.1 upstream_gene_variant ; 2892.0bp to feature; MODIFIER silent_mutation Average:68.815; most accessible tissue: Callus, score: 91.518 N N N N
vg0315008270 A -> C LOC_Os03g26229.1 downstream_gene_variant ; 10.0bp to feature; MODIFIER silent_mutation Average:68.815; most accessible tissue: Callus, score: 91.518 N N N N
vg0315008270 A -> C LOC_Os03g26240.1 downstream_gene_variant ; 485.0bp to feature; MODIFIER silent_mutation Average:68.815; most accessible tissue: Callus, score: 91.518 N N N N
vg0315008270 A -> C LOC_Os03g26229-LOC_Os03g26240 intergenic_region ; MODIFIER silent_mutation Average:68.815; most accessible tissue: Callus, score: 91.518 N N N N
vg0315008270 A -> DEL N N silent_mutation Average:68.815; most accessible tissue: Callus, score: 91.518 N N N N
vg0315008270 A -> G LOC_Os03g26220.1 upstream_gene_variant ; 3707.0bp to feature; MODIFIER silent_mutation Average:68.815; most accessible tissue: Callus, score: 91.518 N N N N
vg0315008270 A -> G LOC_Os03g26250.1 upstream_gene_variant ; 2892.0bp to feature; MODIFIER silent_mutation Average:68.815; most accessible tissue: Callus, score: 91.518 N N N N
vg0315008270 A -> G LOC_Os03g26229.1 downstream_gene_variant ; 10.0bp to feature; MODIFIER silent_mutation Average:68.815; most accessible tissue: Callus, score: 91.518 N N N N
vg0315008270 A -> G LOC_Os03g26240.1 downstream_gene_variant ; 485.0bp to feature; MODIFIER silent_mutation Average:68.815; most accessible tissue: Callus, score: 91.518 N N N N
vg0315008270 A -> G LOC_Os03g26229-LOC_Os03g26240 intergenic_region ; MODIFIER silent_mutation Average:68.815; most accessible tissue: Callus, score: 91.518 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0315008270 9.47E-06 9.47E-06 mr1030 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 NA 2.77E-09 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 3.00E-06 3.00E-06 mr1053 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 NA 1.74E-06 mr1072 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 NA 7.36E-08 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 6.84E-06 6.83E-06 mr1169 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 NA 2.48E-06 mr1170 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 NA 3.18E-07 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 NA 5.39E-07 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 NA 1.88E-06 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 NA 3.18E-06 mr1205 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 NA 4.68E-07 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 NA 1.98E-06 mr1263 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 NA 1.11E-08 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 NA 4.08E-07 mr1289 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 NA 6.12E-06 mr1293 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 NA 7.48E-06 mr1315 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 NA 3.18E-06 mr1318 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 NA 5.01E-07 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 8.37E-06 8.37E-06 mr1357 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 NA 5.34E-07 mr1359 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 NA 3.96E-06 mr1380 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 3.70E-06 3.70E-06 mr1393 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 1.35E-06 1.35E-06 mr1430 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 NA 1.98E-06 mr1451 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 NA 6.21E-06 mr1507 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 NA 7.84E-10 mr1521 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 NA 6.17E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 8.00E-07 8.00E-07 mr1556 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 NA 6.79E-08 mr1576 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 NA 4.84E-06 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 NA 2.43E-06 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 7.67E-06 7.67E-06 mr1643 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 NA 7.80E-07 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 1.16E-06 7.51E-08 mr1683 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 NA 8.50E-06 mr1685 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 NA 4.86E-08 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 NA 6.21E-11 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 NA 5.04E-06 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 NA 6.90E-07 mr1741 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 NA 9.76E-06 mr1763 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 NA 8.86E-08 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 NA 3.21E-06 mr1809 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 NA 4.42E-06 mr1810 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 NA 3.92E-08 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 NA 4.72E-06 mr1906 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 NA 5.19E-06 mr1977 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315008270 NA 2.63E-06 mr1982 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251