\
| Variant ID: vg0314711143 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 14711143 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 78. )
TGGCCTTCCCTTGAGAAAAGTTCTCCTGAGAAAAGCTGGCCCGTATGGTACAAGCGTGTATCGGCTAGCAAGCAGGTTCATTGGGACGAACTAGGAATCA[G/A]
CCAAGCCCTTGCTCTTACTTTAGTAAATTCAGCTAAGGATGAACCCCTGATGGCTTCTGCAACATACTTCTGGTCCAACACCCTCAATGCCTTTATATTT
AAATATAAAGGCATTGAGGGTGTTGGACCAGAAGTATGTTGCAGAAGCCATCAGGGGTTCATCCTTAGCTGAATTTACTAAAGTAAGAGCAAGGGCTTGG[C/T]
TGATTCCTAGTTCGTCCCAATGAACCTGCTTGCTAGCCGATACACGCTTGTACCATACGGGCCAGCTTTTCTCAGGAGAACTTTTCTCAAGGGAAGGCCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.60% | 24.20% | 4.57% | 17.60% | NA |
| All Indica | 2759 | 31.50% | 40.40% | 5.51% | 22.62% | NA |
| All Japonica | 1512 | 98.80% | 0.20% | 0.20% | 0.79% | NA |
| Aus | 269 | 12.30% | 1.50% | 19.33% | 66.91% | NA |
| Indica I | 595 | 25.70% | 41.80% | 3.19% | 29.24% | NA |
| Indica II | 465 | 21.50% | 21.10% | 12.26% | 45.16% | NA |
| Indica III | 913 | 38.70% | 51.90% | 3.07% | 6.35% | NA |
| Indica Intermediate | 786 | 33.50% | 37.30% | 6.11% | 23.16% | NA |
| Temperate Japonica | 767 | 99.70% | 0.10% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 97.60% | 0.20% | 0.60% | 1.59% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.40% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 89.60% | 5.20% | 1.04% | 4.17% | NA |
| Intermediate | 90 | 58.90% | 18.90% | 8.89% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0314711143 | G -> A | LOC_Os03g25700.1 | missense_variant ; p.Ser194Asn; MODERATE | nonsynonymous_codon ; S194N | Average:48.906; most accessible tissue: Zhenshan97 flag leaf, score: 65.3 | benign |
1.438 |
DELETERIOUS | 0.01 |
| vg0314711143 | G -> DEL | LOC_Os03g25700.1 | N | frameshift_variant | Average:48.906; most accessible tissue: Zhenshan97 flag leaf, score: 65.3 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0314711143 | NA | 6.22E-06 | mr1041 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314711143 | 8.66E-06 | 1.87E-08 | mr1302 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314711143 | NA | 4.66E-06 | mr1507 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314711143 | NA | 1.21E-12 | mr1542 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314711143 | 2.03E-06 | 5.68E-09 | mr1604 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314711143 | NA | 9.51E-06 | mr1811 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314711143 | 7.11E-06 | 3.98E-06 | mr1816 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314711143 | 6.95E-07 | 2.63E-09 | mr1886 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314711143 | NA | 9.16E-06 | mr1898 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0314711143 | NA | 7.26E-12 | mr1542_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |