\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0308881162:

Variant ID: vg0308881162 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 8881162
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.05, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


AAGAGTAGTTGTATTGATCTGTGTGATAAATTACATAGACCCCAGGTGTACATATTTATACCCATGGGTTGATACAAGTCCTTGTCGGACAAGAAAGAAA[C/T]
TTTCCTAAAGATAAAAGGAAAACATAAAGTCCTTATCGGACACTAAACACACTTTCCTAAAGATAAAAGGAAACTAACAAACTATTCCTAATTAATAGAT

Reverse complement sequence

ATCTATTAATTAGGAATAGTTTGTTAGTTTCCTTTTATCTTTAGGAAAGTGTGTTTAGTGTCCGATAAGGACTTTATGTTTTCCTTTTATCTTTAGGAAA[G/A]
TTTCTTTCTTGTCCGACAAGGACTTGTATCAACCCATGGGTATAAATATGTACACCTGGGGTCTATGTAATTTATCACACAGATCAATACAACTACTCTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.10% 5.90% 0.00% 0.00% NA
All Indica  2759 98.20% 1.80% 0.00% 0.00% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 22.30% 77.70% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 98.40% 1.60% 0.00% 0.00% NA
Indica Intermediate  786 95.70% 4.30% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 85.40% 14.60% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0308881162 C -> T LOC_Os03g16100.1 upstream_gene_variant ; 1697.0bp to feature; MODIFIER silent_mutation Average:40.599; most accessible tissue: Minghui63 flag leaf, score: 55.068 N N N N
vg0308881162 C -> T LOC_Os03g16110.1 upstream_gene_variant ; 3004.0bp to feature; MODIFIER silent_mutation Average:40.599; most accessible tissue: Minghui63 flag leaf, score: 55.068 N N N N
vg0308881162 C -> T LOC_Os03g16110.3 upstream_gene_variant ; 3004.0bp to feature; MODIFIER silent_mutation Average:40.599; most accessible tissue: Minghui63 flag leaf, score: 55.068 N N N N
vg0308881162 C -> T LOC_Os03g16110.2 upstream_gene_variant ; 3004.0bp to feature; MODIFIER silent_mutation Average:40.599; most accessible tissue: Minghui63 flag leaf, score: 55.068 N N N N
vg0308881162 C -> T LOC_Os03g16090-LOC_Os03g16100 intergenic_region ; MODIFIER silent_mutation Average:40.599; most accessible tissue: Minghui63 flag leaf, score: 55.068 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0308881162 NA 1.59E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308881162 NA 1.36E-08 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308881162 NA 7.56E-08 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308881162 NA 2.26E-09 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308881162 NA 2.10E-08 mr1989 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308881162 NA 1.36E-07 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308881162 3.39E-06 NA mr1529_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308881162 2.08E-06 NA mr1835_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308881162 NA 5.26E-06 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251