Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0308461641:

Variant ID: vg0308461641 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 8461641
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


TTCAAGCATGTGTGTGTGTGTGTGTAAAACATCCTAACCTTTGATGTGTATTTCATAAAAATGGATATAGCTAGCCGATACCTCCAAACTAAGCACGATA[G/C]
AACTTCTCTGAATCTAGCTAGTACTACATTTTTACTTAATTAATTGGTGATGCAGATTTTGTATCATAATGCTATGCTCTCATCTATTAAAGCCATAACA

Reverse complement sequence

TGTTATGGCTTTAATAGATGAGAGCATAGCATTATGATACAAAATCTGCATCACCAATTAATTAAGTAAAAATGTAGTACTAGCTAGATTCAGAGAAGTT[C/G]
TATCGTGCTTAGTTTGGAGGTATCGGCTAGCTATATCCATTTTTATGAAATACACATCAAAGGTTAGGATGTTTTACACACACACACACACATGCTTGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.70% 3.70% 0.63% 0.00% NA
All Indica  2759 99.90% 0.00% 0.04% 0.00% NA
All Japonica  1512 86.70% 11.40% 1.85% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.00% 0.13% 0.00% NA
Temperate Japonica  767 94.70% 3.50% 1.83% 0.00% NA
Tropical Japonica  504 90.10% 9.30% 0.60% 0.00% NA
Japonica Intermediate  241 54.40% 41.10% 4.56% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 1.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0308461641 G -> C LOC_Os03g15440.1 downstream_gene_variant ; 559.0bp to feature; MODIFIER silent_mutation Average:44.31; most accessible tissue: Callus, score: 73.442 N N N N
vg0308461641 G -> C LOC_Os03g15440-LOC_Os03g15450 intergenic_region ; MODIFIER silent_mutation Average:44.31; most accessible tissue: Callus, score: 73.442 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0308461641 NA 1.34E-06 mr1064 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308461641 NA 8.54E-06 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308461641 NA 2.76E-08 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308461641 NA 1.06E-06 mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308461641 NA 2.01E-06 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308461641 NA 9.79E-07 mr1534 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308461641 NA 6.99E-06 mr1691 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308461641 NA 1.51E-07 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308461641 2.00E-06 3.62E-10 mr1745 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308461641 NA 3.84E-06 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308461641 NA 2.38E-07 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308461641 NA 5.33E-10 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308461641 NA 9.29E-10 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308461641 NA 2.77E-08 mr1120_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308461641 NA 3.09E-07 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308461641 NA 1.18E-07 mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308461641 NA 1.44E-06 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308461641 NA 2.23E-06 mr1691_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308461641 NA 3.25E-08 mr1745_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251