\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0304629209:

Variant ID: vg0304629209 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 4629209
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TACGGGATGCCGTGGTGCGACGTCCTGGCTGCTGCCGGCGGCGGCGGCGGCTTCGGTGAGTTTTACGGAGTGGACGAGTGGGATGACCAGCTGCAGGTCG[C/T]
CTCCGTGGATGAGTGGGAGGTGGCATCCAAGGATAACTCGGATGCTTCCACGGAGGGCAAGGCGGCGGCGGCGGAGCGGGCGGAGCCGGTGGCCGCCGGG

Reverse complement sequence

CCCGGCGGCCACCGGCTCCGCCCGCTCCGCCGCCGCCGCCTTGCCCTCCGTGGAAGCATCCGAGTTATCCTTGGATGCCACCTCCCACTCATCCACGGAG[G/A]
CGACCTGCAGCTGGTCATCCCACTCGTCCACTCCGTAAAACTCACCGAAGCCGCCGCCGCCGCCGGCAGCAGCCAGGACGTCGCACCACGGCATCCCGTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.70% 10.10% 0.19% 0.00% NA
All Indica  2759 99.60% 0.40% 0.00% 0.00% NA
All Japonica  1512 69.80% 29.80% 0.46% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.80% 2.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.30% 0.00% 0.00% NA
Temperate Japonica  767 93.60% 6.10% 0.26% 0.00% NA
Tropical Japonica  504 26.00% 73.20% 0.79% 0.00% NA
Japonica Intermediate  241 85.50% 14.10% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 83.30% 14.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0304629209 C -> T LOC_Os03g08930.1 missense_variant ; p.Ala57Val; MODERATE nonsynonymous_codon ; A57V Average:82.642; most accessible tissue: Minghui63 panicle, score: 91.41 unknown unknown TOLERATED 0.32

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0304629209 C T 0.0 -0.01 -0.02 -0.02 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0304629209 NA 1.34E-08 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304629209 NA 7.94E-07 mr1602 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304629209 NA 3.60E-13 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304629209 NA 2.23E-07 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304629209 NA 1.39E-08 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251