\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0303955124:

Variant ID: vg0303955124 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 3955124
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.70, A: 0.30, others allele: 0.00, population size: 43. )

Flanking Sequence (100 bp) in Reference Genome:


TCTCACTATCTCGCTCCCTTGTTTCTCGTGCCCACGCTTCCACTAATCCCATTCGCCCGCTTGCGACGCATGAGGTGGATATGCGGTTGTGGCAGTCGAG[G/A]
CAGATCGTATCGTGCGCGCGTTAATTACGCTCGCCGATCGAAGCGACGTTGCCATATCTCCAGGCGAAGCAAATCGGCTCGCCCAGATTCGTGCGCTGCT

Reverse complement sequence

AGCAGCGCACGAATCTGGGCGAGCCGATTTGCTTCGCCTGGAGATATGGCAACGTCGCTTCGATCGGCGAGCGTAATTAACGCGCGCACGATACGATCTG[C/T]
CTCGACTGCCACAACCGCATATCCACCTCATGCGTCGCAAGCGGGCGAATGGGATTAGTGGAAGCGTGGGCACGAGAAACAAGGGAGCGAGATAGTGAGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.30% 0.90% 26.89% 17.92% NA
All Indica  2759 51.60% 1.50% 31.10% 15.84% NA
All Japonica  1512 62.60% 0.10% 14.48% 22.82% NA
Aus  269 21.90% 0.00% 61.34% 16.73% NA
Indica I  595 39.80% 2.20% 29.08% 28.91% NA
Indica II  465 38.30% 3.00% 44.30% 14.41% NA
Indica III  913 64.80% 0.40% 27.82% 6.90% NA
Indica Intermediate  786 52.90% 1.30% 28.63% 17.18% NA
Temperate Japonica  767 92.80% 0.10% 1.69% 5.35% NA
Tropical Japonica  504 9.10% 0.00% 37.70% 53.17% NA
Japonica Intermediate  241 78.40% 0.00% 6.64% 14.94% NA
VI/Aromatic  96 89.60% 0.00% 8.33% 2.08% NA
Intermediate  90 56.70% 0.00% 23.33% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0303955124 G -> A LOC_Os03g07780.1 upstream_gene_variant ; 306.0bp to feature; MODIFIER silent_mutation Average:33.791; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0303955124 G -> A LOC_Os03g07770.1 downstream_gene_variant ; 4172.0bp to feature; MODIFIER silent_mutation Average:33.791; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0303955124 G -> A LOC_Os03g07780-LOC_Os03g07790 intergenic_region ; MODIFIER silent_mutation Average:33.791; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0303955124 G -> DEL N N silent_mutation Average:33.791; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0303955124 NA 5.87E-06 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303955124 NA 7.63E-10 mr1742 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303955124 NA 3.60E-08 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303955124 NA 1.54E-08 mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303955124 NA 9.53E-06 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303955124 NA 7.47E-07 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251