Variant ID: vg0303955124 (JBrowse) | Variation Type: SNP |
Chromosome: chr03 | Position: 3955124 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.70, A: 0.30, others allele: 0.00, population size: 43. )
TCTCACTATCTCGCTCCCTTGTTTCTCGTGCCCACGCTTCCACTAATCCCATTCGCCCGCTTGCGACGCATGAGGTGGATATGCGGTTGTGGCAGTCGAG[G/A]
CAGATCGTATCGTGCGCGCGTTAATTACGCTCGCCGATCGAAGCGACGTTGCCATATCTCCAGGCGAAGCAAATCGGCTCGCCCAGATTCGTGCGCTGCT
AGCAGCGCACGAATCTGGGCGAGCCGATTTGCTTCGCCTGGAGATATGGCAACGTCGCTTCGATCGGCGAGCGTAATTAACGCGCGCACGATACGATCTG[C/T]
CTCGACTGCCACAACCGCATATCCACCTCATGCGTCGCAAGCGGGCGAATGGGATTAGTGGAAGCGTGGGCACGAGAAACAAGGGAGCGAGATAGTGAGA
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 54.30% | 0.90% | 26.89% | 17.92% | NA |
All Indica | 2759 | 51.60% | 1.50% | 31.10% | 15.84% | NA |
All Japonica | 1512 | 62.60% | 0.10% | 14.48% | 22.82% | NA |
Aus | 269 | 21.90% | 0.00% | 61.34% | 16.73% | NA |
Indica I | 595 | 39.80% | 2.20% | 29.08% | 28.91% | NA |
Indica II | 465 | 38.30% | 3.00% | 44.30% | 14.41% | NA |
Indica III | 913 | 64.80% | 0.40% | 27.82% | 6.90% | NA |
Indica Intermediate | 786 | 52.90% | 1.30% | 28.63% | 17.18% | NA |
Temperate Japonica | 767 | 92.80% | 0.10% | 1.69% | 5.35% | NA |
Tropical Japonica | 504 | 9.10% | 0.00% | 37.70% | 53.17% | NA |
Japonica Intermediate | 241 | 78.40% | 0.00% | 6.64% | 14.94% | NA |
VI/Aromatic | 96 | 89.60% | 0.00% | 8.33% | 2.08% | NA |
Intermediate | 90 | 56.70% | 0.00% | 23.33% | 20.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0303955124 | G -> A | LOC_Os03g07780.1 | upstream_gene_variant ; 306.0bp to feature; MODIFIER | silent_mutation | Average:33.791; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
vg0303955124 | G -> A | LOC_Os03g07770.1 | downstream_gene_variant ; 4172.0bp to feature; MODIFIER | silent_mutation | Average:33.791; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
vg0303955124 | G -> A | LOC_Os03g07780-LOC_Os03g07790 | intergenic_region ; MODIFIER | silent_mutation | Average:33.791; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
vg0303955124 | G -> DEL | N | N | silent_mutation | Average:33.791; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0303955124 | NA | 5.87E-06 | mr1530 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0303955124 | NA | 7.63E-10 | mr1742 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0303955124 | NA | 3.60E-08 | mr1304_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0303955124 | NA | 1.54E-08 | mr1347_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0303955124 | NA | 9.53E-06 | mr1379_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0303955124 | NA | 7.47E-07 | mr1671_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |