\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0300033578:

Variant ID: vg0300033578 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 33578
Reference Allele: CAlternative Allele: G
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAATGAACTTGCCACCCGCGTCGGTCCACTCTTGGGAGGATTTGTGCCAGCAGTTCACCATGAACTTCCAAGGCACATATCCGCGCCCAGTTGAAGAAGC[C/G]
GACTTGCATGCGGTACAGCGAAGGGACGATGAGTCTCTTCGCTCGTACATTCAGCGGTTTTGTCAAGTCCGCAACACACAACCATGCATCCCCGCACACG

Reverse complement sequence

CGTGTGCGGGGATGCATGGTTGTGTGTTGCGGACTTGACAAAACCGCTGAATGTACGAGCGAAGAGACTCATCGTCCCTTCGCTGTACCGCATGCAAGTC[G/C]
GCTTCTTCAACTGGGCGCGGATATGTGCCTTGGAAGTTCATGGTGAACTGCTGGCACAAATCCTCCCAAGAGTGGACCGACGCGGGTGGCAAGTTCATTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.00% 16.70% 3.91% 9.46% NA
All Indica  2759 84.20% 1.80% 2.28% 11.71% NA
All Japonica  1512 45.60% 47.20% 7.14% 0.00% NA
Aus  269 51.70% 1.50% 1.86% 44.98% NA
Indica I  595 92.60% 0.50% 2.18% 4.71% NA
Indica II  465 90.10% 6.70% 2.58% 0.65% NA
Indica III  913 74.80% 0.20% 1.64% 23.33% NA
Indica Intermediate  786 85.40% 1.70% 2.93% 10.05% NA
Temperate Japonica  767 12.30% 78.50% 9.26% 0.00% NA
Tropical Japonica  504 87.50% 9.30% 3.17% 0.00% NA
Japonica Intermediate  241 64.30% 27.00% 8.71% 0.00% NA
VI/Aromatic  96 93.80% 1.00% 5.21% 0.00% NA
Intermediate  90 71.10% 21.10% 4.44% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0300033578 C -> DEL LOC_Os03g01040.1 N frameshift_variant Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0300033578 C -> G LOC_Os03g01040.1 synonymous_variant ; p.Ala291Ala; LOW synonymous_codon Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0300033578 NA 1.68E-06 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300033578 NA 1.91E-07 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300033578 NA 2.82E-06 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300033578 NA 5.82E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300033578 NA 2.26E-06 mr1334 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300033578 NA 1.30E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300033578 NA 1.18E-06 mr1588 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300033578 NA 5.85E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300033578 NA 7.66E-08 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300033578 NA 4.52E-10 mr1790 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300033578 4.14E-06 2.76E-07 mr1790 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300033578 NA 1.54E-07 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300033578 NA 3.82E-07 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300033578 NA 1.17E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300033578 NA 6.96E-07 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300033578 2.42E-06 1.39E-09 mr1334_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300033578 NA 3.52E-07 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300033578 NA 7.40E-11 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300033578 NA 6.55E-07 mr1588_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300033578 NA 5.07E-06 mr1861_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251