RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0234907635:

Variant ID: vg0234907635 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 34907635
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:

AAGTCACTCATAAGGTTTCAGTTTAATTGTTCAGAAAACAAACAAAAAGGAGGACAAATATGGCACTGATAGATCACCAAAAATCAACATGGCCTGGACA[T/G]
TCATCATAGCTTCTCAACTTAAAAGGCAAACAGAGAAGAGGCAAAATCTATTCAATATCCAGTTTGACAATCTGCATGAACTGTCAGTCAATGTGTCATC

Reverse complement sequence

GATGACACATTGACTGACAGTTCATGCAGATTGTCAAACTGGATATTGAATAGATTTTGCCTCTTCTCTGTTTGCCTTTTAAGTTGAGAAGCTATGATGA[A/C]
TGTCCAGGCCATGTTGATTTTTGGTGATCTATCAGTGCCATATTTGTCCTCCTTTTTGTTTGTTTTCTGAACAATTAAACTGAAACCTTATGAGTGACTT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.10%	0.10%	11.87%	8.93%	NA
All Indica	2759	69.70%	0.20%	17.00%	13.12%	NA
All Japonica	1512	95.90%	0.00%	2.58%	1.52%	NA
Aus	269	73.20%	0.40%	15.24%	11.15%	NA
Indica I	595	62.40%	0.30%	29.08%	8.24%	NA
Indica II	465	72.90%	0.00%	15.70%	11.40%	NA
Indica III	913	71.60%	0.10%	10.19%	18.07%	NA
Indica Intermediate	786	71.10%	0.30%	16.54%	12.09%	NA
Temperate Japonica	767	98.40%	0.00%	0.91%	0.65%	NA
Tropical Japonica	504	91.70%	0.00%	5.16%	3.17%	NA
Japonica Intermediate	241	96.70%	0.00%	2.49%	0.83%	NA
VI/Aromatic	96	94.80%	0.00%	3.12%	2.08%	NA
Intermediate	90	84.40%	0.00%	10.00%	5.56%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0234907635	T -> G	LOC_Os02g56950.1	3_prime_UTR_variant ; 246.0bp to feature; MODIFIER	silent_mutation	Average:49.503; most accessible tissue: Minghui63 root, score: 77.009	N	N	N	N
vg0234907635	T -> G	LOC_Os02g56960.1	upstream_gene_variant ; 3395.0bp to feature; MODIFIER	silent_mutation	Average:49.503; most accessible tissue: Minghui63 root, score: 77.009	N	N	N	N
vg0234907635	T -> G	LOC_Os02g56940.1	downstream_gene_variant ; 3732.0bp to feature; MODIFIER	silent_mutation	Average:49.503; most accessible tissue: Minghui63 root, score: 77.009	N	N	N	N
vg0234907635	T -> G	LOC_Os02g56940.2	downstream_gene_variant ; 3732.0bp to feature; MODIFIER	silent_mutation	Average:49.503; most accessible tissue: Minghui63 root, score: 77.009	N	N	N	N
vg0234907635	T -> G	LOC_Os02g56940.3	downstream_gene_variant ; 3732.0bp to feature; MODIFIER	silent_mutation	Average:49.503; most accessible tissue: Minghui63 root, score: 77.009	N	N	N	N
vg0234907635	T -> G	LOC_Os02g56950.2	intron_variant ; MODIFIER	silent_mutation	Average:49.503; most accessible tissue: Minghui63 root, score: 77.009	N	N	N	N
vg0234907635	T -> DEL	N	N	silent_mutation	Average:49.503; most accessible tissue: Minghui63 root, score: 77.009	N	N	N	N

Showing 1 to 7 of 7 entries

Search for Variation information by Variation ID:

Detailed information for vg0234907635:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact