| Variant ID: vg0234906302 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 34906302 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.00, others allele: 0.00, population size: 241. )
ACAGAAACAAAGAAAATGAATGCATTAAAGACTTGAATAGAACAAGTCCCGCCTATTACAGTGATTCCCAAAGAAACACACTGAAGGATAGAAGGAAACA[G/T]
AACAACAAAAAAGAAAATCTTAGAGAGAAATCAGACAAAAGATTACAGAAATGAGTAATTTGATTTGAATTCTGTGTTGCTAAATCTAAATGGTTAATTG
CAATTAACCATTTAGATTTAGCAACACAGAATTCAAATCAAATTACTCATTTCTGTAATCTTTTGTCTGATTTCTCTCTAAGATTTTCTTTTTTGTTGTT[C/A]
TGTTTCCTTCTATCCTTCAGTGTGTTTCTTTGGGAATCACTGTAATAGGCGGGACTTGTTCTATTCAAGTCTTTAATGCATTCATTTTCTTTGTTTCTGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.80% | 38.10% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 89.00% | 10.80% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 16.90% | 83.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 53.20% | 46.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 91.20% | 8.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 85.10% | 14.80% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 88.70% | 10.90% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 7.60% | 92.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 36.50% | 63.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 5.80% | 94.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 11.50% | 87.50% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 60.00% | 40.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0234906302 | G -> T | LOC_Os02g56960.1 | upstream_gene_variant ; 4728.0bp to feature; MODIFIER | silent_mutation | Average:46.894; most accessible tissue: Callus, score: 89.612 | N | N | N | N |
| vg0234906302 | G -> T | LOC_Os02g56930.1 | downstream_gene_variant ; 4922.0bp to feature; MODIFIER | silent_mutation | Average:46.894; most accessible tissue: Callus, score: 89.612 | N | N | N | N |
| vg0234906302 | G -> T | LOC_Os02g56940.1 | downstream_gene_variant ; 2399.0bp to feature; MODIFIER | silent_mutation | Average:46.894; most accessible tissue: Callus, score: 89.612 | N | N | N | N |
| vg0234906302 | G -> T | LOC_Os02g56950.1 | downstream_gene_variant ; 1226.0bp to feature; MODIFIER | silent_mutation | Average:46.894; most accessible tissue: Callus, score: 89.612 | N | N | N | N |
| vg0234906302 | G -> T | LOC_Os02g56940.2 | downstream_gene_variant ; 2399.0bp to feature; MODIFIER | silent_mutation | Average:46.894; most accessible tissue: Callus, score: 89.612 | N | N | N | N |
| vg0234906302 | G -> T | LOC_Os02g56940.3 | downstream_gene_variant ; 2399.0bp to feature; MODIFIER | silent_mutation | Average:46.894; most accessible tissue: Callus, score: 89.612 | N | N | N | N |
| vg0234906302 | G -> T | LOC_Os02g56950.2 | intron_variant ; MODIFIER | silent_mutation | Average:46.894; most accessible tissue: Callus, score: 89.612 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0234906302 | NA | 8.29E-09 | mr1005 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234906302 | NA | 6.15E-06 | mr1125 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234906302 | NA | 4.63E-06 | mr1903 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234906302 | NA | 9.81E-08 | mr1125_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234906302 | NA | 4.37E-09 | mr1526_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/