RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0234905791:

Variant ID: vg0234905791 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 34905791
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.72, G: 0.27, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

TACTACAGTTATAGCTGGCGAAAGATATTGGGGAACTTTTCCATTGCGAAGCTGATTCATAGTTGATGTAGGCCTGTTTCATGTACCCCTAAGATGATTC[A/G]
CTTCAATCTGTTAAAGTGGAGCTCTGGTCATATCATCAGCCAAATGCAGAAGTCTATTACATCAAACTTGAAAACGAAATAAGTTTTCCCTGGTCTTGTT

Reverse complement sequence

AACAAGACCAGGGAAAACTTATTTCGTTTTCAAGTTTGATGTAATAGACTTCTGCATTTGGCTGATGATATGACCAGAGCTCCACTTTAACAGATTGAAG[T/C]
GAATCATCTTAGGGGTACATGAAACAGGCCTACATCAACTATGAATCAGCTTCGCAATGGAAAAGTTCCCCAATATCTTTCGCCAGCTATAACTGTAGTA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.60%	28.40%	0.04%	0.00%	NA
All Indica	2759	99.40%	0.60%	0.00%	0.00%	NA
All Japonica	1512	19.60%	80.30%	0.07%	0.00%	NA
Aus	269	94.80%	5.20%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	98.90%	1.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.40%	0.60%	0.00%	0.00%	NA
Temperate Japonica	767	8.50%	91.50%	0.00%	0.00%	NA
Tropical Japonica	504	42.10%	57.70%	0.20%	0.00%	NA
Japonica Intermediate	241	8.30%	91.70%	0.00%	0.00%	NA
VI/Aromatic	96	34.40%	65.60%	0.00%	0.00%	NA
Intermediate	90	62.20%	36.70%	1.11%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0234905791	A -> G	LOC_Os02g56950.2	3_prime_UTR_variant ; 2090.0bp to feature; MODIFIER	silent_mutation	Average:47.647; most accessible tissue: Callus, score: 82.559	N	N	N	N
vg0234905791	A -> G	LOC_Os02g56930.1	downstream_gene_variant ; 4411.0bp to feature; MODIFIER	silent_mutation	Average:47.647; most accessible tissue: Callus, score: 82.559	N	N	N	N
vg0234905791	A -> G	LOC_Os02g56940.1	downstream_gene_variant ; 1888.0bp to feature; MODIFIER	silent_mutation	Average:47.647; most accessible tissue: Callus, score: 82.559	N	N	N	N
vg0234905791	A -> G	LOC_Os02g56950.1	downstream_gene_variant ; 1737.0bp to feature; MODIFIER	silent_mutation	Average:47.647; most accessible tissue: Callus, score: 82.559	N	N	N	N
vg0234905791	A -> G	LOC_Os02g56940.2	downstream_gene_variant ; 1888.0bp to feature; MODIFIER	silent_mutation	Average:47.647; most accessible tissue: Callus, score: 82.559	N	N	N	N
vg0234905791	A -> G	LOC_Os02g56940.3	downstream_gene_variant ; 1888.0bp to feature; MODIFIER	silent_mutation	Average:47.647; most accessible tissue: Callus, score: 82.559	N	N	N	N

Showing 1 to 6 of 6 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0234905791	NA	3.00E-53	Grain_width	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0234905791	NA	1.41E-12	Grain_width	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0234905791	NA	7.59E-06	mr1125	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234905791	6.48E-06	7.34E-11	mr1188	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234905791	NA	1.08E-06	mr1278	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234905791	NA	1.46E-08	mr1302	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234905791	NA	4.87E-14	mr1376	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234905791	NA	7.63E-07	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234905791	NA	4.87E-14	mr1431	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234905791	NA	2.03E-07	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 21 entries

Previous1 2 3Next

Search for Variation information by Variation ID:

Detailed information for vg0234905791:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact