Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0234417843:

Variant ID: vg0234417843 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 34417843
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:

TATGTTTACATATAACATATTTTTATACAATATCTATTGTGCAAATGCTCCCTATATTAGGCCGATTACCATTTAATACTGAGGGCTTACTCTATTCTTT[T/C]
TGTATATATGACGCTTGTTTACGGTATACATAATACCCGATTCTTAATCCAAATATGCTCATTACATCCTGACAATACTAGAAGATTTATACAATTTTCT

Reverse complement sequence

AGAAAATTGTATAAATCTTCTAGTATTGTCAGGATGTAATGAGCATATTTGGATTAAGAATCGGGTATTATGTATACCGTAAACAAGCGTCATATATACA[A/G]
AAAGAATAGAGTAAGCCCTCAGTATTAAATGGTAATCGGCCTAATATAGGGAGCATTTGCACAATAGATATTGTATAAAAATATGTTATATGTAAACATA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.70%	31.10%	10.54%	9.67%	NA
All Indica	2759	65.60%	1.00%	17.47%	15.95%	NA
All Japonica	1512	9.20%	90.00%	0.40%	0.40%	NA
Aus	269	83.30%	15.20%	0.00%	1.49%	NA
Indica I	595	64.90%	0.30%	22.69%	12.10%	NA
Indica II	465	69.50%	1.70%	16.56%	12.26%	NA
Indica III	913	61.60%	0.40%	14.79%	23.22%	NA
Indica Intermediate	786	68.60%	1.70%	17.18%	12.60%	NA
Temperate Japonica	767	2.60%	96.60%	0.13%	0.65%	NA
Tropical Japonica	504	20.20%	79.20%	0.60%	0.00%	NA
Japonica Intermediate	241	7.10%	91.70%	0.83%	0.41%	NA
VI/Aromatic	96	86.50%	10.40%	2.08%	1.04%	NA
Intermediate	90	48.90%	35.60%	8.89%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0234417843	T -> DEL	N	N	silent_mutation	Average:38.271; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0234417843	T -> C	LOC_Os02g56250.1	downstream_gene_variant ; 4436.0bp to feature; MODIFIER	silent_mutation	Average:38.271; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0234417843	T -> C	LOC_Os02g56260.1	downstream_gene_variant ; 3937.0bp to feature; MODIFIER	silent_mutation	Average:38.271; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0234417843	T -> C	LOC_Os02g56250-LOC_Os02g56260	intergenic_region ; MODIFIER	silent_mutation	Average:38.271; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0234417843	NA	5.48E-23	mr1698	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234417843	NA	2.74E-07	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234417843	NA	1.30E-06	mr1979	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234417843	NA	1.05E-19	mr1042_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234417843	2.70E-06	NA	mr1042_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234417843	6.08E-06	NA	mr1502_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234417843	NA	1.28E-07	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234417843	NA	7.86E-23	mr1698_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251