Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0234309940:

Variant ID: vg0234309940 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 34309940
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, A: 0.05, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


GCGCCGCGACGACACTTCCCTCGCCGAGTCCCGCAGCAGTGGCAGCTTCTCCTCCAGCAGCGAGAGCGGGACGTTGATGGAGTGAGCCATGGACGCTATC[T/A]
GAAAATGGTGCGACGGCCGCACGTCCACCAGCAGGTGCGGCCTGCCGCTGTCGAGCACCTTCTTGTAGTCTCTGCAGCTCACCCGGGCGTTCTCCGGGAG

Reverse complement sequence

CTCCCGGAGAACGCCCGGGTGAGCTGCAGAGACTACAAGAAGGTGCTCGACAGCGGCAGGCCGCACCTGCTGGTGGACGTGCGGCCGTCGCACCATTTTC[A/T]
GATAGCGTCCATGGCTCACTCCATCAACGTCCCGCTCTCGCTGCTGGAGGAGAAGCTGCCACTGCTGCGGGACTCGGCGAGGGAAGTGTCGTCGCGGCGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.70% 47.10% 0.23% 0.00% NA
All Indica  2759 28.20% 71.50% 0.25% 0.00% NA
All Japonica  1512 96.90% 3.00% 0.07% 0.00% NA
Aus  269 59.50% 40.50% 0.00% 0.00% NA
Indica I  595 44.40% 55.50% 0.17% 0.00% NA
Indica II  465 13.80% 86.00% 0.22% 0.00% NA
Indica III  913 21.00% 78.90% 0.11% 0.00% NA
Indica Intermediate  786 33.00% 66.50% 0.51% 0.00% NA
Temperate Japonica  767 97.50% 2.30% 0.13% 0.00% NA
Tropical Japonica  504 97.40% 2.60% 0.00% 0.00% NA
Japonica Intermediate  241 93.80% 6.20% 0.00% 0.00% NA
VI/Aromatic  96 34.40% 65.60% 0.00% 0.00% NA
Intermediate  90 57.80% 38.90% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0234309940 T -> A LOC_Os02g56050.1 missense_variant ; p.Gln88Leu; MODERATE nonsynonymous_codon ; Q88L Average:83.52; most accessible tissue: Zhenshan97 young leaf, score: 91.967 benign -0.232 TOLERATED 0.11

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0234309940 T A -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0234309940 NA 4.57E-06 mr1294_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234309940 NA 3.67E-08 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234309940 NA 7.62E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234309940 NA 4.52E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234309940 NA 6.68E-06 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234309940 NA 7.46E-10 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234309940 NA 2.28E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234309940 NA 1.34E-10 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234309940 NA 2.30E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251