Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0233443892:

Variant ID: vg0233443892 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 33443892
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGCTGCTGCTGCAGCCCCGCCCGCAAGCTCGGCGGCCCGCCCGGTCGCATCGCGACGGCGGCGAGGCGCGGCGCGGCGGGTTGATTGGCTCGCGTCGGCG[T/C]
GTGCGTTTTCTGGTGGGCTCGCGGCGTGGAGAGGACGAGGCCGATCGGGGGCAGGGAGAGGAAGAAGGATTCGAGACAGAGGAGTGTTTTTTTATAGACG

Reverse complement sequence

CGTCTATAAAAAAACACTCCTCTGTCTCGAATCCTTCTTCCTCTCCCTGCCCCCGATCGGCCTCGTCCTCTCCACGCCGCGAGCCCACCAGAAAACGCAC[A/G]
CGCCGACGCGAGCCAATCAACCCGCCGCGCCGCGCCTCGCCGCCGTCGCGATGCGACCGGGCGGGCCGCCGAGCTTGCGGGCGGGGCTGCAGCAGCAGCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.10%	5.80%	3.34%	0.76%	NA
All Indica	2759	97.50%	2.00%	0.47%	0.07%	NA
All Japonica	1512	88.70%	0.20%	8.93%	2.18%	NA
Aus	269	24.90%	74.30%	0.74%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.90%	0.40%	0.65%	0.00%	NA
Indica III	913	97.40%	2.30%	0.33%	0.00%	NA
Indica Intermediate	786	94.80%	4.10%	0.89%	0.25%	NA
Temperate Japonica	767	93.40%	0.00%	6.13%	0.52%	NA
Tropical Japonica	504	82.70%	0.20%	12.30%	4.76%	NA
Japonica Intermediate	241	86.30%	0.80%	10.79%	2.07%	NA
VI/Aromatic	96	88.50%	8.30%	3.12%	0.00%	NA
Intermediate	90	85.60%	7.80%	5.56%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0233443892	T -> DEL	N	N	silent_mutation	Average:96.309; most accessible tissue: Minghui63 young leaf, score: 99.328	N	N	N	N
vg0233443892	T -> C	LOC_Os02g54600.1	5_prime_UTR_variant ; 51.0bp to feature; MODIFIER	silent_mutation	Average:96.309; most accessible tissue: Minghui63 young leaf, score: 99.328	N	N	N	N
vg0233443892	T -> C	LOC_Os02g54590.1	downstream_gene_variant ; 4678.0bp to feature; MODIFIER	silent_mutation	Average:96.309; most accessible tissue: Minghui63 young leaf, score: 99.328	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0233443892	T	C	-0.05	-0.07	-0.05	0.0	-0.04	-0.05