\
| Variant ID: vg0228555399 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 28555399 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 236. )
AAGTAAAGGAGGAATTCCCTCCCAATTACCTGCCCCTACCCAGGTATTGAAAATGAGGGAGTTTCTTCCTCAATTCCCCATCCCCATCCCACCAAAATTC[C/T]
CATGTCTCCCAACCAAACAAAACACTTAATAGCATCATCCCTCTAAACTCCCAATCTCTCCTAAAAACTCCCTCCAACCAAACGGGCCGTCAAGGTCCTA
TAGGACCTTGACGGCCCGTTTGGTTGGAGGGAGTTTTTAGGAGAGATTGGGAGTTTAGAGGGATGATGCTATTAAGTGTTTTGTTTGGTTGGGAGACATG[G/A]
GAATTTTGGTGGGATGGGGATGGGGAATTGAGGAAGAAACTCCCTCATTTTCAATACCTGGGTAGGGGCAGGTAATTGGGAGGGAATTCCTCCTTTACTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.10% | 4.70% | 0.28% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 85.80% | 13.40% | 0.79% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 87.90% | 12.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 80.60% | 17.30% | 2.18% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.50% | 9.10% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 6.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0228555399 | C -> T | LOC_Os02g46750.1 | upstream_gene_variant ; 3515.0bp to feature; MODIFIER | silent_mutation | Average:62.837; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| vg0228555399 | C -> T | LOC_Os02g46770.1 | upstream_gene_variant ; 395.0bp to feature; MODIFIER | silent_mutation | Average:62.837; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| vg0228555399 | C -> T | LOC_Os02g46750.2 | upstream_gene_variant ; 3520.0bp to feature; MODIFIER | silent_mutation | Average:62.837; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| vg0228555399 | C -> T | LOC_Os02g46750.3 | upstream_gene_variant ; 3520.0bp to feature; MODIFIER | silent_mutation | Average:62.837; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| vg0228555399 | C -> T | LOC_Os02g46750.5 | upstream_gene_variant ; 3520.0bp to feature; MODIFIER | silent_mutation | Average:62.837; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| vg0228555399 | C -> T | LOC_Os02g46750.4 | upstream_gene_variant ; 3515.0bp to feature; MODIFIER | silent_mutation | Average:62.837; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| vg0228555399 | C -> T | LOC_Os02g46760.1 | downstream_gene_variant ; 1638.0bp to feature; MODIFIER | silent_mutation | Average:62.837; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| vg0228555399 | C -> T | LOC_Os02g46780.1 | downstream_gene_variant ; 2687.0bp to feature; MODIFIER | silent_mutation | Average:62.837; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| vg0228555399 | C -> T | LOC_Os02g46760-LOC_Os02g46770 | intergenic_region ; MODIFIER | silent_mutation | Average:62.837; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0228555399 | 7.84E-07 | NA | mr1035_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228555399 | 8.25E-06 | 8.25E-06 | mr1166_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228555399 | NA | 1.72E-10 | mr1379_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228555399 | NA | 9.35E-07 | mr1379_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228555399 | NA | 4.93E-06 | mr1386_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228555399 | NA | 5.00E-07 | mr1559_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228555399 | NA | 8.87E-07 | mr1562_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228555399 | NA | 1.35E-06 | mr1727_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228555399 | 7.08E-06 | 2.19E-06 | mr1831_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228555399 | NA | 2.41E-06 | mr1840_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228555399 | 8.05E-07 | 1.53E-08 | mr1849_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228555399 | NA | 1.00E-06 | mr1849_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228555399 | 8.10E-06 | NA | mr1850_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228555399 | NA | 5.62E-10 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228555399 | 4.23E-06 | NA | mr1942_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |