\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0228545798:

Variant ID: vg0228545798 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 28545798
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


ATAATTACATAATCTGTCAGTAAACCGCGAGACGAATTTATTAAGCCTAATTAATCCGTCATTAGTAAATGTTTATTGTAGCACCACATTGTCAAATCAT[A/G]
GAGCAATTAGACTTAAAAAATTCGTCTCACAAATTAGTCGTAATCTGTGCAATTAGTTTTTTTAGACTATATTTAATAATACTTCATGCAGATGTTCAAA

Reverse complement sequence

TTTGAACATCTGCATGAAGTATTATTAAATATAGTCTAAAAAAACTAATTGCACAGATTACGACTAATTTGTGAGACGAATTTTTTAAGTCTAATTGCTC[T/C]
ATGATTTGACAATGTGGTGCTACAATAAACATTTACTAATGACGGATTAATTAGGCTTAATAAATTCGTCTCGCGGTTTACTGACAGATTATGTAATTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.10% 38.00% 0.66% 0.28% NA
All Indica  2759 90.10% 8.80% 0.65% 0.47% NA
All Japonica  1512 20.80% 78.50% 0.66% 0.00% NA
Aus  269 17.10% 82.90% 0.00% 0.00% NA
Indica I  595 98.80% 1.00% 0.00% 0.17% NA
Indica II  465 93.30% 5.40% 0.65% 0.65% NA
Indica III  913 87.00% 11.90% 0.55% 0.55% NA
Indica Intermediate  786 85.10% 13.10% 1.27% 0.51% NA
Temperate Japonica  767 12.60% 87.20% 0.13% 0.00% NA
Tropical Japonica  504 38.10% 60.50% 1.39% 0.00% NA
Japonica Intermediate  241 10.80% 88.40% 0.83% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 44.40% 52.20% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0228545798 A -> G LOC_Os02g46730.1 downstream_gene_variant ; 2774.0bp to feature; MODIFIER silent_mutation Average:65.077; most accessible tissue: Zhenshan97 panicle, score: 82.888 N N N N
vg0228545798 A -> G LOC_Os02g46750.1 downstream_gene_variant ; 2553.0bp to feature; MODIFIER silent_mutation Average:65.077; most accessible tissue: Zhenshan97 panicle, score: 82.888 N N N N
vg0228545798 A -> G LOC_Os02g46750.2 downstream_gene_variant ; 2553.0bp to feature; MODIFIER silent_mutation Average:65.077; most accessible tissue: Zhenshan97 panicle, score: 82.888 N N N N
vg0228545798 A -> G LOC_Os02g46750.3 downstream_gene_variant ; 2553.0bp to feature; MODIFIER silent_mutation Average:65.077; most accessible tissue: Zhenshan97 panicle, score: 82.888 N N N N
vg0228545798 A -> G LOC_Os02g46750.5 downstream_gene_variant ; 2553.0bp to feature; MODIFIER silent_mutation Average:65.077; most accessible tissue: Zhenshan97 panicle, score: 82.888 N N N N
vg0228545798 A -> G LOC_Os02g46750.4 downstream_gene_variant ; 2553.0bp to feature; MODIFIER silent_mutation Average:65.077; most accessible tissue: Zhenshan97 panicle, score: 82.888 N N N N
vg0228545798 A -> G LOC_Os02g46740.1 intron_variant ; MODIFIER silent_mutation Average:65.077; most accessible tissue: Zhenshan97 panicle, score: 82.888 N N N N
vg0228545798 A -> DEL N N silent_mutation Average:65.077; most accessible tissue: Zhenshan97 panicle, score: 82.888 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0228545798 NA 1.37E-19 mr1422 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228545798 NA 7.61E-16 mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228545798 NA 5.82E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228545798 NA 1.89E-14 mr1228_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228545798 NA 1.37E-07 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228545798 NA 9.09E-07 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228545798 NA 3.26E-26 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228545798 NA 8.67E-08 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228545798 NA 1.47E-21 mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228545798 NA 3.23E-16 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228545798 NA 5.34E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228545798 NA 7.35E-06 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228545798 NA 2.42E-15 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228545798 NA 5.94E-09 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228545798 NA 9.16E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228545798 NA 8.05E-08 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228545798 NA 4.56E-09 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251