\
| Variant ID: vg0228545798 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 28545798 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 232. )
ATAATTACATAATCTGTCAGTAAACCGCGAGACGAATTTATTAAGCCTAATTAATCCGTCATTAGTAAATGTTTATTGTAGCACCACATTGTCAAATCAT[A/G]
GAGCAATTAGACTTAAAAAATTCGTCTCACAAATTAGTCGTAATCTGTGCAATTAGTTTTTTTAGACTATATTTAATAATACTTCATGCAGATGTTCAAA
TTTGAACATCTGCATGAAGTATTATTAAATATAGTCTAAAAAAACTAATTGCACAGATTACGACTAATTTGTGAGACGAATTTTTTAAGTCTAATTGCTC[T/C]
ATGATTTGACAATGTGGTGCTACAATAAACATTTACTAATGACGGATTAATTAGGCTTAATAAATTCGTCTCGCGGTTTACTGACAGATTATGTAATTAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.10% | 38.00% | 0.66% | 0.28% | NA |
| All Indica | 2759 | 90.10% | 8.80% | 0.65% | 0.47% | NA |
| All Japonica | 1512 | 20.80% | 78.50% | 0.66% | 0.00% | NA |
| Aus | 269 | 17.10% | 82.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.80% | 1.00% | 0.00% | 0.17% | NA |
| Indica II | 465 | 93.30% | 5.40% | 0.65% | 0.65% | NA |
| Indica III | 913 | 87.00% | 11.90% | 0.55% | 0.55% | NA |
| Indica Intermediate | 786 | 85.10% | 13.10% | 1.27% | 0.51% | NA |
| Temperate Japonica | 767 | 12.60% | 87.20% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 38.10% | 60.50% | 1.39% | 0.00% | NA |
| Japonica Intermediate | 241 | 10.80% | 88.40% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 44.40% | 52.20% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0228545798 | A -> G | LOC_Os02g46730.1 | downstream_gene_variant ; 2774.0bp to feature; MODIFIER | silent_mutation | Average:65.077; most accessible tissue: Zhenshan97 panicle, score: 82.888 | N | N | N | N |
| vg0228545798 | A -> G | LOC_Os02g46750.1 | downstream_gene_variant ; 2553.0bp to feature; MODIFIER | silent_mutation | Average:65.077; most accessible tissue: Zhenshan97 panicle, score: 82.888 | N | N | N | N |
| vg0228545798 | A -> G | LOC_Os02g46750.2 | downstream_gene_variant ; 2553.0bp to feature; MODIFIER | silent_mutation | Average:65.077; most accessible tissue: Zhenshan97 panicle, score: 82.888 | N | N | N | N |
| vg0228545798 | A -> G | LOC_Os02g46750.3 | downstream_gene_variant ; 2553.0bp to feature; MODIFIER | silent_mutation | Average:65.077; most accessible tissue: Zhenshan97 panicle, score: 82.888 | N | N | N | N |
| vg0228545798 | A -> G | LOC_Os02g46750.5 | downstream_gene_variant ; 2553.0bp to feature; MODIFIER | silent_mutation | Average:65.077; most accessible tissue: Zhenshan97 panicle, score: 82.888 | N | N | N | N |
| vg0228545798 | A -> G | LOC_Os02g46750.4 | downstream_gene_variant ; 2553.0bp to feature; MODIFIER | silent_mutation | Average:65.077; most accessible tissue: Zhenshan97 panicle, score: 82.888 | N | N | N | N |
| vg0228545798 | A -> G | LOC_Os02g46740.1 | intron_variant ; MODIFIER | silent_mutation | Average:65.077; most accessible tissue: Zhenshan97 panicle, score: 82.888 | N | N | N | N |
| vg0228545798 | A -> DEL | N | N | silent_mutation | Average:65.077; most accessible tissue: Zhenshan97 panicle, score: 82.888 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0228545798 | NA | 1.37E-19 | mr1422 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228545798 | NA | 7.61E-16 | mr1807 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228545798 | NA | 5.82E-09 | mr1198_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228545798 | NA | 1.89E-14 | mr1228_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228545798 | NA | 1.37E-07 | mr1376_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228545798 | NA | 9.09E-07 | mr1379_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228545798 | NA | 3.26E-26 | mr1422_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228545798 | NA | 8.67E-08 | mr1431_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228545798 | NA | 1.47E-21 | mr1531_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228545798 | NA | 3.23E-16 | mr1583_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228545798 | NA | 5.34E-06 | mr1606_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228545798 | NA | 7.35E-06 | mr1677_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228545798 | NA | 2.42E-15 | mr1807_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228545798 | NA | 5.94E-09 | mr1860_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228545798 | NA | 9.16E-06 | mr1869_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228545798 | NA | 8.05E-08 | mr1885_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0228545798 | NA | 4.56E-09 | mr1942_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |