\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225876283:

Variant ID: vg0225876283 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 25876283
Reference Allele: GAlternative Allele: A,GTAT,GTATGTCCAAATTCATAATACA,GTATGTCCAAATTCGTAATACA
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATTACATTTAATATGGAGTAGATTGGTTTTTAATATATGTATGTCCAAATTCGTAATACCAGAATATTACATTTAATATAGAGTAGATTGGTTTTTTAT[G/A,GTAT,GTATGTCCAAATTCATAATACA,GTATGTCCAAATTCGTAATACA]
GAATGAAGAGAGTACTCAAGACTTGATTATGCAATAAACTACTGGAGTAATGGCCATCCTTGATTTTTTTGGTCTGAACTCTGAAGAAAGATTTCGCCCA

Reverse complement sequence

TGGGCGAAATCTTTCTTCAGAGTTCAGACCAAAAAAATCAAGGATGGCCATTACTCCAGTAGTTTATTGCATAATCAAGTCTTGAGTACTCTCTTCATTC[C/T,ATAC,TGTATTATGAATTTGGACATAC,TGTATTACGAATTTGGACATAC]
ATAAAAAACCAATCTACTCTATATTAAATGTAATATTCTGGTATTACGAATTTGGACATACATATATTAAAAACCAATCTACTCCATATTAAATGTAATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.60% 5.20% 0.87% 13.50% GTATGTCCAAATTCGTAATACA: 0.44%; GTATGTCCAAATTCATAATACA: 0.30%; GTAT: 0.11%
All Indica  2759 98.20% 0.20% 0.11% 0.91% GTATGTCCAAATTCGTAATACA: 0.54%; GTAT: 0.07%
All Japonica  1512 49.80% 9.10% 2.18% 38.96% NA
Aus  269 86.60% 3.00% 1.49% 0.37% GTATGTCCAAATTCATAATACA: 5.20%; GTATGTCCAAATTCGTAATACA: 2.23%; GTAT: 1.12%
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.70% 0.40% 0.00% 0.22% GTAT: 0.43%; GTATGTCCAAATTCGTAATACA: 0.22%
Indica III  913 98.40% 0.30% 0.00% 0.77% GTATGTCCAAATTCGTAATACA: 0.55%
Indica Intermediate  786 96.20% 0.10% 0.38% 2.16% GTATGTCCAAATTCGTAATACA: 1.15%
Temperate Japonica  767 80.60% 1.00% 1.04% 17.34% NA
Tropical Japonica  504 14.90% 9.10% 3.57% 72.42% NA
Japonica Intermediate  241 24.90% 34.40% 2.90% 37.76% NA
VI/Aromatic  96 6.20% 84.40% 0.00% 9.38% NA
Intermediate  90 68.90% 14.40% 1.11% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0225876283 G -> A LOC_Os02g42990.1 upstream_gene_variant ; 2618.0bp to feature; MODIFIER silent_mutation Average:94.541; most accessible tissue: Callus, score: 97.941 N N N N
vg0225876283 G -> A LOC_Os02g42980.1 downstream_gene_variant ; 3505.0bp to feature; MODIFIER silent_mutation Average:94.541; most accessible tissue: Callus, score: 97.941 N N N N
vg0225876283 G -> A LOC_Os02g42980-LOC_Os02g42990 intergenic_region ; MODIFIER silent_mutation Average:94.541; most accessible tissue: Callus, score: 97.941 N N N N
vg0225876283 G -> DEL N N silent_mutation Average:94.541; most accessible tissue: Callus, score: 97.941 N N N N
vg0225876283 G -> GTATGTCCAAATTCATAATACA LOC_Os02g42990.1 upstream_gene_variant ; 2617.0bp to feature; MODIFIER silent_mutation Average:94.541; most accessible tissue: Callus, score: 97.941 N N N N
vg0225876283 G -> GTATGTCCAAATTCATAATACA LOC_Os02g42980.1 downstream_gene_variant ; 3506.0bp to feature; MODIFIER silent_mutation Average:94.541; most accessible tissue: Callus, score: 97.941 N N N N
vg0225876283 G -> GTATGTCCAAATTCATAATACA LOC_Os02g42980-LOC_Os02g42990 intergenic_region ; MODIFIER silent_mutation Average:94.541; most accessible tissue: Callus, score: 97.941 N N N N
vg0225876283 G -> GTATGTCCAAATTCGTAATACA LOC_Os02g42990.1 upstream_gene_variant ; 2617.0bp to feature; MODIFIER silent_mutation Average:94.541; most accessible tissue: Callus, score: 97.941 N N N N
vg0225876283 G -> GTATGTCCAAATTCGTAATACA LOC_Os02g42980.1 downstream_gene_variant ; 3506.0bp to feature; MODIFIER silent_mutation Average:94.541; most accessible tissue: Callus, score: 97.941 N N N N
vg0225876283 G -> GTATGTCCAAATTCGTAATACA LOC_Os02g42980-LOC_Os02g42990 intergenic_region ; MODIFIER silent_mutation Average:94.541; most accessible tissue: Callus, score: 97.941 N N N N
vg0225876283 G -> GTAT LOC_Os02g42990.1 upstream_gene_variant ; 2617.0bp to feature; MODIFIER silent_mutation Average:94.541; most accessible tissue: Callus, score: 97.941 N N N N
vg0225876283 G -> GTAT LOC_Os02g42980.1 downstream_gene_variant ; 3506.0bp to feature; MODIFIER silent_mutation Average:94.541; most accessible tissue: Callus, score: 97.941 N N N N
vg0225876283 G -> GTAT LOC_Os02g42980-LOC_Os02g42990 intergenic_region ; MODIFIER silent_mutation Average:94.541; most accessible tissue: Callus, score: 97.941 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0225876283 G A 0.03 0.01 -0.02 -0.02 -0.02 -0.02
vg0225876283 G GTAT -0.25 -0.34 -0.26 -0.24 -0.14 -0.14
vg0225876283 G GTATG* -0.68 -0.36 -0.27 -0.26 -0.35 -0.55

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0225876283 NA 4.79E-06 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225876283 NA 2.03E-09 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225876283 3.60E-09 NA mr1745 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225876283 1.86E-08 1.92E-08 mr1745 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225876283 NA 3.22E-06 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225876283 NA 9.09E-07 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225876283 NA 6.10E-06 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225876283 NA 2.72E-06 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225876283 NA 4.40E-07 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225876283 NA 4.82E-07 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225876283 NA 9.08E-06 mr1438_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225876283 4.92E-06 NA mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225876283 NA 6.12E-09 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225876283 2.46E-10 NA mr1745_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225876283 1.19E-06 2.15E-07 mr1745_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251