\
| Variant ID: vg0225258958 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 25258958 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGCAATTATGCATTTAGCATCCATACTAAATTATTTTACACATAATTTTCTTCAAAATTTGTTAAAATAGTCTTATCATTGTCTTAGAATTTTAACAATC[G/A]
AACCTTATCATCGTTGGGATTTCAATTTTATAATTTTTGAAAGCTACACCAGTCGTCACCCCTTATTTATTTGTCGCTCCATTATTTGCTTGTCTAGTCT
AGACTAGACAAGCAAATAATGGAGCGACAAATAAATAAGGGGTGACGACTGGTGTAGCTTTCAAAAATTATAAAATTGAAATCCCAACGATGATAAGGTT[C/T]
GATTGTTAAAATTCTAAGACAATGATAAGACTATTTTAACAAATTTTGAAGAAAATTATGTGTAAAATAATTTAGTATGGATGCTAAATGCATAATTGCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.30% | 4.60% | 1.29% | 1.78% | NA |
| All Indica | 2759 | 94.60% | 0.30% | 2.07% | 3.04% | NA |
| All Japonica | 1512 | 86.40% | 13.40% | 0.20% | 0.00% | NA |
| Aus | 269 | 98.90% | 0.70% | 0.37% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 86.00% | 0.20% | 5.48% | 8.32% | NA |
| Indica Intermediate | 786 | 97.50% | 0.60% | 0.89% | 1.02% | NA |
| Temperate Japonica | 767 | 81.20% | 18.40% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 74.30% | 25.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0225258958 | G -> A | LOC_Os02g42020.1 | upstream_gene_variant ; 2472.0bp to feature; MODIFIER | silent_mutation | Average:42.619; most accessible tissue: Minghui63 panicle, score: 79.811 | N | N | N | N |
| vg0225258958 | G -> A | LOC_Os02g42030.1 | upstream_gene_variant ; 3202.0bp to feature; MODIFIER | silent_mutation | Average:42.619; most accessible tissue: Minghui63 panicle, score: 79.811 | N | N | N | N |
| vg0225258958 | G -> A | LOC_Os02g42020.2 | upstream_gene_variant ; 3621.0bp to feature; MODIFIER | silent_mutation | Average:42.619; most accessible tissue: Minghui63 panicle, score: 79.811 | N | N | N | N |
| vg0225258958 | G -> A | LOC_Os02g42020.3 | upstream_gene_variant ; 2472.0bp to feature; MODIFIER | silent_mutation | Average:42.619; most accessible tissue: Minghui63 panicle, score: 79.811 | N | N | N | N |
| vg0225258958 | G -> A | LOC_Os02g42020-LOC_Os02g42030 | intergenic_region ; MODIFIER | silent_mutation | Average:42.619; most accessible tissue: Minghui63 panicle, score: 79.811 | N | N | N | N |
| vg0225258958 | G -> DEL | N | N | silent_mutation | Average:42.619; most accessible tissue: Minghui63 panicle, score: 79.811 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0225258958 | 1.60E-06 | 5.90E-09 | mr1013 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225258958 | NA | 2.35E-07 | mr1031 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225258958 | NA | 3.64E-06 | mr1056 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225258958 | 1.45E-06 | 1.45E-06 | mr1036_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |