\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225258958:

Variant ID: vg0225258958 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 25258958
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCAATTATGCATTTAGCATCCATACTAAATTATTTTACACATAATTTTCTTCAAAATTTGTTAAAATAGTCTTATCATTGTCTTAGAATTTTAACAATC[G/A]
AACCTTATCATCGTTGGGATTTCAATTTTATAATTTTTGAAAGCTACACCAGTCGTCACCCCTTATTTATTTGTCGCTCCATTATTTGCTTGTCTAGTCT

Reverse complement sequence

AGACTAGACAAGCAAATAATGGAGCGACAAATAAATAAGGGGTGACGACTGGTGTAGCTTTCAAAAATTATAAAATTGAAATCCCAACGATGATAAGGTT[C/T]
GATTGTTAAAATTCTAAGACAATGATAAGACTATTTTAACAAATTTTGAAGAAAATTATGTGTAAAATAATTTAGTATGGATGCTAAATGCATAATTGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.30% 4.60% 1.29% 1.78% NA
All Indica  2759 94.60% 0.30% 2.07% 3.04% NA
All Japonica  1512 86.40% 13.40% 0.20% 0.00% NA
Aus  269 98.90% 0.70% 0.37% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 86.00% 0.20% 5.48% 8.32% NA
Indica Intermediate  786 97.50% 0.60% 0.89% 1.02% NA
Temperate Japonica  767 81.20% 18.40% 0.39% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 74.30% 25.70% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0225258958 G -> A LOC_Os02g42020.1 upstream_gene_variant ; 2472.0bp to feature; MODIFIER silent_mutation Average:42.619; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg0225258958 G -> A LOC_Os02g42030.1 upstream_gene_variant ; 3202.0bp to feature; MODIFIER silent_mutation Average:42.619; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg0225258958 G -> A LOC_Os02g42020.2 upstream_gene_variant ; 3621.0bp to feature; MODIFIER silent_mutation Average:42.619; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg0225258958 G -> A LOC_Os02g42020.3 upstream_gene_variant ; 2472.0bp to feature; MODIFIER silent_mutation Average:42.619; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg0225258958 G -> A LOC_Os02g42020-LOC_Os02g42030 intergenic_region ; MODIFIER silent_mutation Average:42.619; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg0225258958 G -> DEL N N silent_mutation Average:42.619; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0225258958 1.60E-06 5.90E-09 mr1013 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225258958 NA 2.35E-07 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225258958 NA 3.64E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225258958 1.45E-06 1.45E-06 mr1036_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251