| Variant ID: vg0225148780 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 25148780 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 168. )
CGTTCATTGACATGATAGGCAGTGAAAACCTTATCCAATAATGGCTTTCCTTCTTGGACCTCCACATGATGACACAGAGGCAATTATTGGCTATACTTTT[T/C]
CCTTTTCGCTTCCTCTTCCCTTATTTCTTCTCCAAAGCAAGATGCTGGTGAACTTACCGTGCCTCCTCCCTCCTCTTCCACCACTTTGGCGAGACAATAG
CTATTGTCTCGCCAAAGTGGTGGAAGAGGAGGGAGGAGGCACGGTAAGTTCACCAGCATCTTGCTTTGGAGAAGAAATAAGGGAAGAGGAAGCGAAAAGG[A/G]
AAAAGTATAGCCAATAATTGCCTCTGTGTCATCATGTGGAGGTCCAAGAAGGAAAGCCATTATTGGATAAGGTTTTCACTGCCTATCATGTCAATGAACG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.50% | 31.10% | 0.28% | 0.06% | NA |
| All Indica | 2759 | 72.90% | 26.70% | 0.29% | 0.11% | NA |
| All Japonica | 1512 | 68.70% | 31.10% | 0.26% | 0.00% | NA |
| Aus | 269 | 17.80% | 82.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 85.70% | 13.90% | 0.34% | 0.00% | NA |
| Indica II | 465 | 72.00% | 27.30% | 0.43% | 0.22% | NA |
| Indica III | 913 | 68.30% | 31.50% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 69.10% | 30.30% | 0.38% | 0.25% | NA |
| Temperate Japonica | 767 | 49.50% | 49.90% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 82.30% | 17.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 30.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0225148780 | T -> DEL | N | N | silent_mutation | Average:70.036; most accessible tissue: Callus, score: 90.938 | N | N | N | N |
| vg0225148780 | T -> C | LOC_Os02g41830.1 | upstream_gene_variant ; 1671.0bp to feature; MODIFIER | silent_mutation | Average:70.036; most accessible tissue: Callus, score: 90.938 | N | N | N | N |
| vg0225148780 | T -> C | LOC_Os02g41810.1 | downstream_gene_variant ; 3058.0bp to feature; MODIFIER | silent_mutation | Average:70.036; most accessible tissue: Callus, score: 90.938 | N | N | N | N |
| vg0225148780 | T -> C | LOC_Os02g41840.1 | downstream_gene_variant ; 4419.0bp to feature; MODIFIER | silent_mutation | Average:70.036; most accessible tissue: Callus, score: 90.938 | N | N | N | N |
| vg0225148780 | T -> C | LOC_Os02g41820.1 | intron_variant ; MODIFIER | silent_mutation | Average:70.036; most accessible tissue: Callus, score: 90.938 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0225148780 | NA | 5.05E-08 | mr1054 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225148780 | NA | 9.33E-07 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225148780 | NA | 5.57E-06 | mr1283 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225148780 | NA | 2.36E-07 | mr1287 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225148780 | NA | 7.08E-07 | mr1320 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225148780 | NA | 3.41E-06 | mr1349 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225148780 | NA | 6.50E-07 | mr1353 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225148780 | NA | 4.42E-07 | mr1372 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225148780 | NA | 2.75E-06 | mr1432 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225148780 | NA | 2.54E-07 | mr1596 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/