\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225148780:

Variant ID: vg0225148780 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 25148780
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 168. )

Flanking Sequence (100 bp) in Reference Genome:


CGTTCATTGACATGATAGGCAGTGAAAACCTTATCCAATAATGGCTTTCCTTCTTGGACCTCCACATGATGACACAGAGGCAATTATTGGCTATACTTTT[T/C]
CCTTTTCGCTTCCTCTTCCCTTATTTCTTCTCCAAAGCAAGATGCTGGTGAACTTACCGTGCCTCCTCCCTCCTCTTCCACCACTTTGGCGAGACAATAG

Reverse complement sequence

CTATTGTCTCGCCAAAGTGGTGGAAGAGGAGGGAGGAGGCACGGTAAGTTCACCAGCATCTTGCTTTGGAGAAGAAATAAGGGAAGAGGAAGCGAAAAGG[A/G]
AAAAGTATAGCCAATAATTGCCTCTGTGTCATCATGTGGAGGTCCAAGAAGGAAAGCCATTATTGGATAAGGTTTTCACTGCCTATCATGTCAATGAACG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.50% 31.10% 0.28% 0.06% NA
All Indica  2759 72.90% 26.70% 0.29% 0.11% NA
All Japonica  1512 68.70% 31.10% 0.26% 0.00% NA
Aus  269 17.80% 82.20% 0.00% 0.00% NA
Indica I  595 85.70% 13.90% 0.34% 0.00% NA
Indica II  465 72.00% 27.30% 0.43% 0.22% NA
Indica III  913 68.30% 31.50% 0.11% 0.00% NA
Indica Intermediate  786 69.10% 30.30% 0.38% 0.25% NA
Temperate Japonica  767 49.50% 49.90% 0.52% 0.00% NA
Tropical Japonica  504 86.70% 13.30% 0.00% 0.00% NA
Japonica Intermediate  241 91.70% 8.30% 0.00% 0.00% NA
VI/Aromatic  96 82.30% 17.70% 0.00% 0.00% NA
Intermediate  90 68.90% 30.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0225148780 T -> DEL N N silent_mutation Average:70.036; most accessible tissue: Callus, score: 90.938 N N N N
vg0225148780 T -> C LOC_Os02g41830.1 upstream_gene_variant ; 1671.0bp to feature; MODIFIER silent_mutation Average:70.036; most accessible tissue: Callus, score: 90.938 N N N N
vg0225148780 T -> C LOC_Os02g41810.1 downstream_gene_variant ; 3058.0bp to feature; MODIFIER silent_mutation Average:70.036; most accessible tissue: Callus, score: 90.938 N N N N
vg0225148780 T -> C LOC_Os02g41840.1 downstream_gene_variant ; 4419.0bp to feature; MODIFIER silent_mutation Average:70.036; most accessible tissue: Callus, score: 90.938 N N N N
vg0225148780 T -> C LOC_Os02g41820.1 intron_variant ; MODIFIER silent_mutation Average:70.036; most accessible tissue: Callus, score: 90.938 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0225148780 NA 5.05E-08 mr1054 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225148780 NA 9.33E-07 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225148780 NA 5.57E-06 mr1283 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225148780 NA 2.36E-07 mr1287 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225148780 NA 7.08E-07 mr1320 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225148780 NA 3.41E-06 mr1349 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225148780 NA 6.50E-07 mr1353 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225148780 NA 4.42E-07 mr1372 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225148780 NA 2.75E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225148780 NA 2.54E-07 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225148780 NA 7.45E-06 mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225148780 NA 6.01E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225148780 NA 2.51E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225148780 NA 3.95E-10 mr1906 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225148780 NA 1.90E-06 mr1941 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225148780 NA 1.78E-06 mr1960 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225148780 NA 5.67E-06 mr1985 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225148780 NA 1.23E-07 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225148780 NA 2.43E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225148780 NA 1.75E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251