Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225008927:

Variant ID: vg0225008927 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 25008927
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


AGGCTGGCGGTACTCCGCCACCATCCTCTTCACCTCGTCGAGGTGGCTCCCCGTCATCTCCTCCGTGGCCTTCCCCCAGTTCAGCGGGTCGGCGCGGGGC[G/A]
CCGCGACGCAGAGACCACTCATGCCATTGGCAGAAACGCGGCCGTTCTCGCACTCCATTTCAGTACCAGAAGATGGATCGGTTAACCTAGCACAGAAAGC

Reverse complement sequence

GCTTTCTGTGCTAGGTTAACCGATCCATCTTCTGGTACTGAAATGGAGTGCGAGAACGGCCGCGTTTCTGCCAATGGCATGAGTGGTCTCTGCGTCGCGG[C/T]
GCCCCGCGCCGACCCGCTGAACTGGGGGAAGGCCACGGAGGAGATGACGGGGAGCCACCTCGACGAGGTGAAGAGGATGGTGGCGGAGTACCGCCAGCCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.70% 22.30% 0.00% 0.00% NA
All Indica  2759 92.60% 7.40% 0.00% 0.00% NA
All Japonica  1512 49.20% 50.80% 0.00% 0.00% NA
Aus  269 84.80% 15.20% 0.00% 0.00% NA
Indica I  595 94.30% 5.70% 0.00% 0.00% NA
Indica II  465 96.30% 3.70% 0.00% 0.00% NA
Indica III  913 90.70% 9.30% 0.00% 0.00% NA
Indica Intermediate  786 91.20% 8.80% 0.00% 0.00% NA
Temperate Japonica  767 67.50% 32.50% 0.00% 0.00% NA
Tropical Japonica  504 20.40% 79.60% 0.00% 0.00% NA
Japonica Intermediate  241 51.00% 49.00% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 64.40% 35.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0225008927 G -> A LOC_Os02g41680.1 missense_variant ; p.Ala20Val; MODERATE nonsynonymous_codon ; A20V Average:91.973; most accessible tissue: Zhenshan97 root, score: 98.633 unknown unknown TOLERATED 0.35

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0225008927 G A -0.01 -0.04 -0.05 -0.01 -0.02 -0.05