Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225007849:

Variant ID: vg0225007849 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 25007849
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 127. )

Flanking Sequence (100 bp) in Reference Genome:


CGCTCGATGGACTTGGTGGCGGCGCGGATAACCTCAATTTGAGGGCCGAGCCACTGTGGGGATGTCCGGAGCGCGTACCGGTCTTGCTTCGGCTTCATCA[G/A]
TGGGTCGAGCTCACCAAGCTTCTTGGCATGCTTCATGTAGGAGCTTCCCTCCAAGATGTGCTCCATGATGGCGGCGGCCTCGATCTGTCCTGGATGGTGC

Reverse complement sequence

GCACCATCCAGGACAGATCGAGGCCGCCGCCATCATGGAGCACATCTTGGAGGGAAGCTCCTACATGAAGCATGCCAAGAAGCTTGGTGAGCTCGACCCA[C/T]
TGATGAAGCCGAAGCAAGACCGGTACGCGCTCCGGACATCCCCACAGTGGCTCGGCCCTCAAATTGAGGTTATCCGCGCCGCCACCAAGTCCATCGAGCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.90% 24.00% 0.06% 0.00% NA
All Indica  2759 61.00% 38.90% 0.11% 0.00% NA
All Japonica  1512 98.40% 1.60% 0.00% 0.00% NA
Aus  269 92.60% 7.40% 0.00% 0.00% NA
Indica I  595 44.40% 55.50% 0.17% 0.00% NA
Indica II  465 71.60% 28.20% 0.22% 0.00% NA
Indica III  913 54.50% 45.50% 0.00% 0.00% NA
Indica Intermediate  786 74.80% 25.10% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 95.20% 4.80% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0225007849 G -> A LOC_Os02g41680.1 synonymous_variant ; p.Leu340Leu; LOW synonymous_codon Average:80.998; most accessible tissue: Zhenshan97 root, score: 94.102 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0225007849 G A -0.03 -0.04 -0.02 -0.02 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0225007849 NA 6.33E-10 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225007849 NA 9.10E-07 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225007849 NA 8.73E-06 mr1686 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225007849 NA 7.64E-09 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225007849 NA 7.35E-06 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225007849 NA 7.04E-09 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225007849 NA 8.01E-06 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251