\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223074046:

Variant ID: vg0223074046 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 23074046
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


ACGAAGTGAGTAGGAGGAGGTGCGACGCCCGTGGAAAGCGATGGGAGAAAAAAAAACAAGCGAACCGTTTTTTTAATGGCAGAGGTGGGTAATTTTTTTC[T/C]
CCCAAAAATAGGTGAAAGCAGGGGGGTAGATGTGCTTTTGATTTGTACTACACCAAAAGCTGGCTTTGGGTAAAAGCAGCCGTAGCTTTTGAACCCTTTG

Reverse complement sequence

CAAAGGGTTCAAAAGCTACGGCTGCTTTTACCCAAAGCCAGCTTTTGGTGTAGTACAAATCAAAAGCACATCTACCCCCCTGCTTTCACCTATTTTTGGG[A/G]
GAAAAAAATTACCCACCTCTGCCATTAAAAAAACGGTTCGCTTGTTTTTTTTTCTCCCATCGCTTTCCACGGGCGTCGCACCTCCTCCTACTCACTTCGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.50% 14.00% 1.88% 0.61% NA
All Indica  2759 97.60% 1.00% 0.62% 0.83% NA
All Japonica  1512 55.20% 40.50% 4.23% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 96.60% 1.30% 2.02% 0.00% NA
Indica II  465 99.10% 0.60% 0.22% 0.00% NA
Indica III  913 98.50% 0.20% 0.00% 1.31% NA
Indica Intermediate  786 96.30% 1.80% 0.51% 1.40% NA
Temperate Japonica  767 41.70% 54.10% 4.17% 0.00% NA
Tropical Japonica  504 66.90% 29.20% 3.97% 0.00% NA
Japonica Intermediate  241 73.90% 21.20% 4.98% 0.00% NA
VI/Aromatic  96 89.60% 0.00% 4.17% 6.25% NA
Intermediate  90 72.20% 23.30% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223074046 T -> DEL N N silent_mutation Average:67.422; most accessible tissue: Minghui63 root, score: 77.009 N N N N
vg0223074046 T -> C LOC_Os02g38140.1 upstream_gene_variant ; 2053.0bp to feature; MODIFIER silent_mutation Average:67.422; most accessible tissue: Minghui63 root, score: 77.009 N N N N
vg0223074046 T -> C LOC_Os02g38140.2 upstream_gene_variant ; 1511.0bp to feature; MODIFIER silent_mutation Average:67.422; most accessible tissue: Minghui63 root, score: 77.009 N N N N
vg0223074046 T -> C LOC_Os02g38140-LOC_Os02g38160 intergenic_region ; MODIFIER silent_mutation Average:67.422; most accessible tissue: Minghui63 root, score: 77.009 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223074046 NA 3.25E-13 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223074046 NA 7.92E-07 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223074046 6.65E-06 6.65E-06 mr1053_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223074046 2.44E-06 2.44E-06 mr1147_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223074046 NA 1.27E-06 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223074046 NA 7.42E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223074046 3.96E-06 3.96E-06 mr1302_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223074046 3.04E-06 3.04E-06 mr1418_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223074046 NA 3.45E-06 mr1419_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223074046 NA 7.83E-07 mr1420_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223074046 4.12E-06 4.12E-06 mr1440_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223074046 NA 1.88E-06 mr1488_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223074046 NA 8.93E-06 mr1492_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223074046 4.79E-06 4.78E-06 mr1506_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223074046 NA 1.78E-08 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223074046 NA 4.72E-07 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223074046 NA 7.66E-06 mr1556_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223074046 3.03E-07 4.03E-07 mr1596_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223074046 4.69E-06 9.09E-09 mr1596_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223074046 8.12E-07 8.11E-07 mr1604_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223074046 NA 5.85E-06 mr1646_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223074046 NA 3.99E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223074046 NA 8.38E-06 mr1736_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223074046 NA 6.60E-06 mr1751_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223074046 NA 5.32E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223074046 NA 5.22E-06 mr1779_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223074046 NA 1.79E-06 mr1813_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223074046 1.85E-06 1.85E-06 mr1824_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223074046 NA 4.87E-08 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223074046 NA 5.04E-07 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223074046 NA 6.20E-06 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223074046 NA 6.97E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223074046 NA 1.72E-06 mr1894_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251