Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222935242:

Variant ID: vg0222935242 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22935242
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.78, C: 0.22, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


ATCATACTACGAAAATGGAATCCACTGTTGTGTTTGTTTGGTGGCATGCATATGTAGATCAATATAGCAAGTTCAATCGATGTAGGCTCGTCTGGGACAC[T/C]
CGAAATGAAATGATTTTGCAGAATTCATTTTGAAAATTCTCTTTTCGAAGCGAGTCATAAAGAGGAATATGCATGTTTTCCCCCCTTTTCTCCCTCTTTT

Reverse complement sequence

AAAAGAGGGAGAAAAGGGGGGAAAACATGCATATTCCTCTTTATGACTCGCTTCGAAAAGAGAATTTTCAAAATGAATTCTGCAAAATCATTTCATTTCG[A/G]
GTGTCCCAGACGAGCCTACATCGATTGAACTTGCTATATTGATCTACATATGCATGCCACCAAACAAACACAACAGTGGATTCCATTTTCGTAGTATGAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.90% 5.10% 0.00% 0.00% NA
All Indica  2759 96.60% 3.40% 0.00% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 47.60% 52.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 93.10% 6.90% 0.00% 0.00% NA
Indica Intermediate  786 96.90% 3.10% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222935242 T -> C LOC_Os02g37950.1 5_prime_UTR_variant ; 315.0bp to feature; MODIFIER silent_mutation Average:76.129; most accessible tissue: Minghui63 flag leaf, score: 84.227 N N N N
vg0222935242 T -> C LOC_Os02g37950.3 5_prime_UTR_variant ; 315.0bp to feature; MODIFIER silent_mutation Average:76.129; most accessible tissue: Minghui63 flag leaf, score: 84.227 N N N N
vg0222935242 T -> C LOC_Os02g37940.1 upstream_gene_variant ; 1748.0bp to feature; MODIFIER silent_mutation Average:76.129; most accessible tissue: Minghui63 flag leaf, score: 84.227 N N N N
vg0222935242 T -> C LOC_Os02g37940.2 upstream_gene_variant ; 1697.0bp to feature; MODIFIER silent_mutation Average:76.129; most accessible tissue: Minghui63 flag leaf, score: 84.227 N N N N
vg0222935242 T -> C LOC_Os02g37930.1 downstream_gene_variant ; 4764.0bp to feature; MODIFIER silent_mutation Average:76.129; most accessible tissue: Minghui63 flag leaf, score: 84.227 N N N N
vg0222935242 T -> C LOC_Os02g37950.2 intron_variant ; MODIFIER silent_mutation Average:76.129; most accessible tissue: Minghui63 flag leaf, score: 84.227 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222935242 1.42E-06 6.67E-23 mr1095 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222935242 2.14E-10 5.98E-37 mr1098 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222935242 2.79E-06 1.80E-29 mr1099 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222935242 2.74E-09 4.87E-35 mr1101 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222935242 1.30E-12 2.45E-30 mr1113 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222935242 4.93E-17 2.36E-39 mr1114 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222935242 4.02E-15 2.70E-32 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222935242 8.85E-18 1.01E-42 mr1117 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222935242 6.40E-13 8.31E-22 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222935242 6.33E-12 5.02E-32 mr1119 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222935242 3.94E-10 7.95E-30 mr1120 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222935242 8.17E-18 9.01E-49 mr1123 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222935242 3.05E-09 2.23E-25 mr1150 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222935242 3.16E-13 4.56E-29 mr1240 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222935242 6.48E-16 9.88E-37 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222935242 1.97E-14 5.93E-39 mr1247 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222935242 1.85E-13 1.36E-25 mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222935242 2.25E-18 3.77E-37 mr1496 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222935242 NA 2.65E-22 mr1589 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222935242 NA 8.45E-12 mr1612 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222935242 9.08E-08 3.32E-29 mr1858 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222935242 8.79E-08 3.04E-29 mr1859 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222935242 NA 4.56E-25 mr1868 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222935242 2.30E-13 2.84E-32 mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222935242 7.79E-13 2.95E-29 mr1936 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222935242 4.50E-08 6.36E-25 mr1961 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222935242 3.72E-06 3.88E-33 mr1098_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222935242 2.31E-06 1.26E-28 mr1099_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222935242 8.82E-16 2.19E-39 mr1113_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222935242 6.15E-16 5.75E-41 mr1114_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222935242 6.19E-17 5.63E-43 mr1117_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222935242 1.03E-14 1.04E-23 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222935242 3.29E-15 7.60E-40 mr1119_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222935242 5.97E-13 8.90E-41 mr1120_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222935242 1.47E-16 1.67E-48 mr1123_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222935242 9.12E-06 NA mr1150_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222935242 8.93E-15 2.17E-35 mr1240_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222935242 7.36E-18 1.27E-41 mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222935242 4.91E-14 1.24E-44 mr1247_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222935242 1.34E-10 NA mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222935242 4.01E-19 1.28E-36 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222935242 6.55E-10 1.20E-26 mr1936_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222935242 6.21E-08 7.07E-22 mr1961_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251