Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222934159:

Variant ID: vg0222934159 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 22934159
Reference Allele: ACGCCGGCGCCGCCGCTCTCGTGAGCCACCGCCACAlternative Allele: A
Primary Allele: ACGCCGGCGCCGCCGCTCTC GTGAGCCACCGCCACSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTGGGCCGTCCTACCAAGTAGGCAAGCACACTGCTCGGGAGGTCGGGATTTTCTTTTCTTTTTTTTTTTTCCGTCGCTTCTTCGCGCCGCCTCCCCTCG[ACGCCGGCGCCGCCGCTCTCGTGAGCCACCGCCAC/A]
CGCCGGCGCCGCCGCTCTCGTGAGCCACCGCCACCGCCGGCGCCGCCGAGCCTCCTCCTCCGGCAAGACGTCTCATCCAGGCCTCTCCCTCCCCCTCAGA

Reverse complement sequence

TCTGAGGGGGAGGGAGAGGCCTGGATGAGACGTCTTGCCGGAGGAGGAGGCTCGGCGGCGCCGGCGGTGGCGGTGGCTCACGAGAGCGGCGGCGCCGGCG[GTGGCGGTGGCTCACGAGAGCGGCGGCGCCGGCGT/T]
CGAGGGGAGGCGGCGCGAAGAAGCGACGGAAAAAAAAAAAAGAAAAGAAAATCCCGACCTCCCGAGCAGTGTGCTTGCCTACTTGGTAGGACGGCCCAAG

Allele Frequencies:

Populations Population SizeFrequency of ACGCCGGCGCCGCCGCTCTC GTGAGCCACCGCCAC(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.30% 3.40% 6.26% 0.00% NA
All Indica  2759 93.00% 2.00% 4.97% 0.00% NA
All Japonica  1512 83.50% 6.50% 9.99% 0.00% NA
Aus  269 97.80% 1.10% 1.12% 0.00% NA
Indica I  595 88.40% 0.30% 11.26% 0.00% NA
Indica II  465 93.50% 3.00% 3.44% 0.00% NA
Indica III  913 97.40% 2.40% 0.22% 0.00% NA
Indica Intermediate  786 91.20% 2.20% 6.62% 0.00% NA
Temperate Japonica  767 73.90% 9.90% 16.17% 0.00% NA
Tropical Japonica  504 98.20% 0.00% 1.79% 0.00% NA
Japonica Intermediate  241 83.00% 9.50% 7.47% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 91.10% 4.40% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222934159 ACGCCGGCGCCGCCGCTCTCGTGAGCCACCGCCAC -> A LOC_Os02g37950.1 5_prime_UTR_variant ; 1316.0bp to feature; MODIFIER silent_mutation Average:98.802; most accessible tissue: Zhenshan97 flower, score: 99.604 N N N N
vg0222934159 ACGCCGGCGCCGCCGCTCTCGTGAGCCACCGCCAC -> A LOC_Os02g37950.2 5_prime_UTR_variant ; 1316.0bp to feature; MODIFIER silent_mutation Average:98.802; most accessible tissue: Zhenshan97 flower, score: 99.604 N N N N
vg0222934159 ACGCCGGCGCCGCCGCTCTCGTGAGCCACCGCCAC -> A LOC_Os02g37950.3 5_prime_UTR_variant ; 1316.0bp to feature; MODIFIER silent_mutation Average:98.802; most accessible tissue: Zhenshan97 flower, score: 99.604 N N N N
vg0222934159 ACGCCGGCGCCGCCGCTCTCGTGAGCCACCGCCAC -> A LOC_Os02g37940.1 upstream_gene_variant ; 666.0bp to feature; MODIFIER silent_mutation Average:98.802; most accessible tissue: Zhenshan97 flower, score: 99.604 N N N N
vg0222934159 ACGCCGGCGCCGCCGCTCTCGTGAGCCACCGCCAC -> A LOC_Os02g37940.2 upstream_gene_variant ; 615.0bp to feature; MODIFIER silent_mutation Average:98.802; most accessible tissue: Zhenshan97 flower, score: 99.604 N N N N
vg0222934159 ACGCCGGCGCCGCCGCTCTCGTGAGCCACCGCCAC -> A LOC_Os02g37930.1 downstream_gene_variant ; 3682.0bp to feature; MODIFIER silent_mutation Average:98.802; most accessible tissue: Zhenshan97 flower, score: 99.604 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0222934159 ACGCC* A 0.04 0.0 -0.03 0.01 0.0 0.02