Variant ID: vg0222778846 (JBrowse) | Variation Type: SNP |
Chromosome: chr02 | Position: 22778846 |
Reference Allele: C | Alternative Allele: G,T |
Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 115. )
ACATAATATCATGAACCTATTAGAGTAGCATATTCTAGTAGAAAATGATGAGCAATATTTTAGAAATTTAACCTTGTAAACATCTAATATTTATGATTGT[C/G,T]
GGGAATACGTTATTGTGGCTAACAGCTATAGATGGAAGATGGTCAAATGAGCTATCTGGCCCGATTACAACCGGGCTCAGGTCCAAGATCAGTCGGAACG
CGTTCCGACTGATCTTGGACCTGAGCCCGGTTGTAATCGGGCCAGATAGCTCATTTGACCATCTTCCATCTATAGCTGTTAGCCACAATAACGTATTCCC[G/C,A]
ACAATCATAAATATTAGATGTTTACAAGGTTAAATTTCTAAAATATTGCTCATCATTTTCTACTAGAATATGCTACTCTAATAGGTTCATGATATTATGT
Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 43.80% | 10.10% | 3.41% | 42.68% | NA |
All Indica | 2759 | 34.90% | 1.00% | 2.07% | 61.98% | NA |
All Japonica | 1512 | 63.00% | 29.00% | 6.42% | 1.65% | NA |
Aus | 269 | 3.30% | 0.00% | 1.86% | 94.80% | NA |
Indica I | 595 | 18.30% | 2.20% | 3.87% | 75.63% | NA |
Indica II | 465 | 37.40% | 0.40% | 2.37% | 59.78% | NA |
Indica III | 913 | 43.30% | 0.00% | 0.33% | 56.41% | NA |
Indica Intermediate | 786 | 36.40% | 1.70% | 2.54% | 59.41% | NA |
Temperate Japonica | 767 | 38.10% | 51.90% | 9.78% | 0.26% | NA |
Tropical Japonica | 504 | 91.70% | 2.20% | 2.18% | 3.97% | NA |
Japonica Intermediate | 241 | 82.20% | 12.00% | 4.56% | 1.24% | NA |
VI/Aromatic | 96 | 89.60% | 1.00% | 0.00% | 9.38% | NA |
Intermediate | 90 | 67.80% | 10.00% | 2.22% | 20.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0222778846 | C -> G | LOC_Os02g37750.1 | upstream_gene_variant ; 362.0bp to feature; MODIFIER | silent_mutation | Average:12.181; most accessible tissue: Callus, score: 62.225 | N | N | N | N |
vg0222778846 | C -> G | LOC_Os02g37730.1 | downstream_gene_variant ; 4588.0bp to feature; MODIFIER | silent_mutation | Average:12.181; most accessible tissue: Callus, score: 62.225 | N | N | N | N |
vg0222778846 | C -> G | LOC_Os02g37740.1 | downstream_gene_variant ; 1924.0bp to feature; MODIFIER | silent_mutation | Average:12.181; most accessible tissue: Callus, score: 62.225 | N | N | N | N |
vg0222778846 | C -> G | LOC_Os02g37760.1 | downstream_gene_variant ; 3904.0bp to feature; MODIFIER | silent_mutation | Average:12.181; most accessible tissue: Callus, score: 62.225 | N | N | N | N |
vg0222778846 | C -> G | LOC_Os02g37750-LOC_Os02g37760 | intergenic_region ; MODIFIER | silent_mutation | Average:12.181; most accessible tissue: Callus, score: 62.225 | N | N | N | N |
vg0222778846 | C -> T | LOC_Os02g37750.1 | upstream_gene_variant ; 362.0bp to feature; MODIFIER | N | Average:12.181; most accessible tissue: Callus, score: 62.225 | N | N | N | N |
vg0222778846 | C -> T | LOC_Os02g37730.1 | downstream_gene_variant ; 4588.0bp to feature; MODIFIER | N | Average:12.181; most accessible tissue: Callus, score: 62.225 | N | N | N | N |
vg0222778846 | C -> T | LOC_Os02g37740.1 | downstream_gene_variant ; 1924.0bp to feature; MODIFIER | N | Average:12.181; most accessible tissue: Callus, score: 62.225 | N | N | N | N |
vg0222778846 | C -> T | LOC_Os02g37760.1 | downstream_gene_variant ; 3904.0bp to feature; MODIFIER | N | Average:12.181; most accessible tissue: Callus, score: 62.225 | N | N | N | N |
vg0222778846 | C -> T | LOC_Os02g37750-LOC_Os02g37760 | intergenic_region ; MODIFIER | N | Average:12.181; most accessible tissue: Callus, score: 62.225 | N | N | N | N |
vg0222778846 | C -> DEL | N | N | silent_mutation | Average:12.181; most accessible tissue: Callus, score: 62.225 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0222778846 | 1.93E-06 | NA | mr1166 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222778846 | 4.18E-06 | 4.18E-06 | mr1166 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222778846 | 1.16E-08 | NA | mr1210 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222778846 | 6.23E-06 | NA | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222778846 | 1.87E-08 | NA | mr1305 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222778846 | 8.39E-06 | NA | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222778846 | 5.00E-06 | NA | mr1515 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222778846 | 5.73E-07 | NA | mr1585 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222778846 | 2.21E-06 | NA | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222778846 | 1.02E-09 | NA | mr1586 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222778846 | 4.14E-06 | NA | mr1765 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222778846 | NA | 1.64E-06 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222778846 | 3.72E-06 | NA | mr1305_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222778846 | 3.44E-06 | NA | mr1585_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222778846 | NA | 3.97E-08 | mr1977_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222778846 | NA | 2.68E-06 | mr1977_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |