\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222170664:

Variant ID: vg0222170664 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 22170664
Reference Allele: GAlternative Allele: A,GAAAATTGGCGTGCCGATT
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


AGCGAGCGGTCTACAGCCTACACAGCCCAGCGAGTATGATGCCTGCTGTTTTTTTTTCTTCGCCGGTGGGCCGTGTGTTCGGATGAGATATGGTCATTTA[G/A,GAAAATTGGCGTGCCGATT]
GGCTGGTTTGGTTCGTGGCCTAAATTGGCCTTACCAATTTTTGTTAATGTTAAATTTTGGTAACTTTTGTCATGGCTAATTTTGGCAAAGGTAAAATTGT

Reverse complement sequence

ACAATTTTACCTTTGCCAAAATTAGCCATGACAAAAGTTACCAAAATTTAACATTAACAAAAATTGGTAAGGCCAATTTAGGCCACGAACCAAACCAGCC[C/T,AATCGGCACGCCAATTTTC]
TAAATGACCATATCTCATCCGAACACACGGCCCACCGGCGAAGAAAAAAAAACAGCAGGCATCATACTCGCTGGGCTGTGTAGGCTGTAGACCGCTCGCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.10% 15.00% 1.93% 46.87% GAAAATTGGCGTGCCGATT: 0.08%
All Indica  2759 7.20% 24.90% 2.94% 64.81% GAAAATTGGCGTGCCGATT: 0.11%
All Japonica  1512 93.00% 0.70% 0.20% 6.08% NA
Aus  269 0.40% 0.40% 2.23% 96.65% GAAAATTGGCGTGCCGATT: 0.37%
Indica I  595 3.90% 28.20% 1.18% 66.72% NA
Indica II  465 1.50% 8.00% 8.17% 82.15% GAAAATTGGCGTGCCGATT: 0.22%
Indica III  913 10.20% 32.50% 1.75% 55.42% GAAAATTGGCGTGCCGATT: 0.11%
Indica Intermediate  786 9.80% 23.50% 2.54% 63.99% GAAAATTGGCGTGCCGATT: 0.13%
Temperate Japonica  767 98.30% 0.10% 0.00% 1.56% NA
Tropical Japonica  504 83.70% 1.80% 0.60% 13.89% NA
Japonica Intermediate  241 95.40% 0.40% 0.00% 4.15% NA
VI/Aromatic  96 60.40% 1.00% 0.00% 38.54% NA
Intermediate  90 46.70% 10.00% 1.11% 42.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222170664 G -> A LOC_Os02g36740.1 upstream_gene_variant ; 3281.0bp to feature; MODIFIER silent_mutation Average:86.851; most accessible tissue: Callus, score: 97.59 N N N N
vg0222170664 G -> A LOC_Os02g36749.1 upstream_gene_variant ; 512.0bp to feature; MODIFIER silent_mutation Average:86.851; most accessible tissue: Callus, score: 97.59 N N N N
vg0222170664 G -> A LOC_Os02g36770.1 upstream_gene_variant ; 4259.0bp to feature; MODIFIER silent_mutation Average:86.851; most accessible tissue: Callus, score: 97.59 N N N N
vg0222170664 G -> A LOC_Os02g36740.8 upstream_gene_variant ; 3396.0bp to feature; MODIFIER silent_mutation Average:86.851; most accessible tissue: Callus, score: 97.59 N N N N
vg0222170664 G -> A LOC_Os02g36740.2 upstream_gene_variant ; 3396.0bp to feature; MODIFIER silent_mutation Average:86.851; most accessible tissue: Callus, score: 97.59 N N N N
vg0222170664 G -> A LOC_Os02g36740.4 upstream_gene_variant ; 3396.0bp to feature; MODIFIER silent_mutation Average:86.851; most accessible tissue: Callus, score: 97.59 N N N N
vg0222170664 G -> A LOC_Os02g36740.5 upstream_gene_variant ; 3396.0bp to feature; MODIFIER silent_mutation Average:86.851; most accessible tissue: Callus, score: 97.59 N N N N
vg0222170664 G -> A LOC_Os02g36740.7 upstream_gene_variant ; 3396.0bp to feature; MODIFIER silent_mutation Average:86.851; most accessible tissue: Callus, score: 97.59 N N N N
vg0222170664 G -> A LOC_Os02g36740.3 upstream_gene_variant ; 3388.0bp to feature; MODIFIER silent_mutation Average:86.851; most accessible tissue: Callus, score: 97.59 N N N N
vg0222170664 G -> A LOC_Os02g36760.1 downstream_gene_variant ; 2002.0bp to feature; MODIFIER silent_mutation Average:86.851; most accessible tissue: Callus, score: 97.59 N N N N
vg0222170664 G -> A LOC_Os02g36749-LOC_Os02g36760 intergenic_region ; MODIFIER silent_mutation Average:86.851; most accessible tissue: Callus, score: 97.59 N N N N
vg0222170664 G -> GAAAATTGGCGTGCCGATT LOC_Os02g36740.1 upstream_gene_variant ; 3282.0bp to feature; MODIFIER silent_mutation Average:86.851; most accessible tissue: Callus, score: 97.59 N N N N
vg0222170664 G -> GAAAATTGGCGTGCCGATT LOC_Os02g36749.1 upstream_gene_variant ; 513.0bp to feature; MODIFIER silent_mutation Average:86.851; most accessible tissue: Callus, score: 97.59 N N N N
vg0222170664 G -> GAAAATTGGCGTGCCGATT LOC_Os02g36770.1 upstream_gene_variant ; 4258.0bp to feature; MODIFIER silent_mutation Average:86.851; most accessible tissue: Callus, score: 97.59 N N N N
vg0222170664 G -> GAAAATTGGCGTGCCGATT LOC_Os02g36740.8 upstream_gene_variant ; 3397.0bp to feature; MODIFIER silent_mutation Average:86.851; most accessible tissue: Callus, score: 97.59 N N N N
vg0222170664 G -> GAAAATTGGCGTGCCGATT LOC_Os02g36740.2 upstream_gene_variant ; 3397.0bp to feature; MODIFIER silent_mutation Average:86.851; most accessible tissue: Callus, score: 97.59 N N N N
vg0222170664 G -> GAAAATTGGCGTGCCGATT LOC_Os02g36740.4 upstream_gene_variant ; 3397.0bp to feature; MODIFIER silent_mutation Average:86.851; most accessible tissue: Callus, score: 97.59 N N N N
vg0222170664 G -> GAAAATTGGCGTGCCGATT LOC_Os02g36740.5 upstream_gene_variant ; 3397.0bp to feature; MODIFIER silent_mutation Average:86.851; most accessible tissue: Callus, score: 97.59 N N N N
vg0222170664 G -> GAAAATTGGCGTGCCGATT LOC_Os02g36740.7 upstream_gene_variant ; 3397.0bp to feature; MODIFIER silent_mutation Average:86.851; most accessible tissue: Callus, score: 97.59 N N N N
vg0222170664 G -> GAAAATTGGCGTGCCGATT LOC_Os02g36740.3 upstream_gene_variant ; 3389.0bp to feature; MODIFIER silent_mutation Average:86.851; most accessible tissue: Callus, score: 97.59 N N N N
vg0222170664 G -> GAAAATTGGCGTGCCGATT LOC_Os02g36760.1 downstream_gene_variant ; 2001.0bp to feature; MODIFIER silent_mutation Average:86.851; most accessible tissue: Callus, score: 97.59 N N N N
vg0222170664 G -> GAAAATTGGCGTGCCGATT LOC_Os02g36749-LOC_Os02g36760 intergenic_region ; MODIFIER silent_mutation Average:86.851; most accessible tissue: Callus, score: 97.59 N N N N
vg0222170664 G -> DEL N N silent_mutation Average:86.851; most accessible tissue: Callus, score: 97.59 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0222170664 G A -0.08 -0.07 -0.05 -0.05 -0.04 -0.04
vg0222170664 G GAAAA* -0.21 -0.36 -0.42 -0.13 -0.22 -0.28

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222170664 NA 8.73E-07 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222170664 NA 2.60E-06 mr1212 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222170664 NA 1.99E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222170664 NA 5.85E-06 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222170664 NA 3.45E-10 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222170664 NA 6.56E-13 mr1329 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222170664 NA 2.21E-08 mr1763 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222170664 NA 1.72E-08 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222170664 NA 2.56E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222170664 NA 5.53E-06 mr1981 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251