RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0220870008:

Variant ID: vg0220870008 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 20870008
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 318. )

Flanking Sequence (100 bp) in Reference Genome:

ACACACCTTGAAGTAACTGTTATCAAACTTCAACCATTCAACTGTCCATGATTGCCCTCCAGGTTCACCAGGCCCATCCTTCTGTAGACCACAATAATAG[A/G]
AGCCACCTTTAAATGTCAGTCTGAAAACTGAAACTAATCTGATTTGCTATTGTGCTGGTGTGATTAAGGTAAGATTGCATCGAAAAGTTAATCTTCATTT

Reverse complement sequence

AAATGAAGATTAACTTTTCGATGCAATCTTACCTTAATCACACCAGCACAATAGCAAATCAGATTAGTTTCAGTTTTCAGACTGACATTTAAAGGTGGCT[T/C]
CTATTATTGTGGTCTACAGAAGGATGGGCCTGGTGAACCTGGAGGGCAATCATGGACAGTTGAATGGTTGAAGTTTGATAACAGTTACTTCAAGGTGTGT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.00%	30.00%	0.04%	0.00%	NA
All Indica	2759	98.70%	1.30%	0.00%	0.00%	NA
All Japonica	1512	17.60%	82.30%	0.07%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	98.30%	1.70%	0.00%	0.00%	NA
Indica III	913	98.80%	1.20%	0.00%	0.00%	NA
Indica Intermediate	786	98.30%	1.70%	0.00%	0.00%	NA
Temperate Japonica	767	26.10%	73.80%	0.13%	0.00%	NA
Tropical Japonica	504	9.70%	90.30%	0.00%	0.00%	NA
Japonica Intermediate	241	7.10%	92.90%	0.00%	0.00%	NA
VI/Aromatic	96	8.30%	91.70%	0.00%	0.00%	NA
Intermediate	90	46.70%	52.20%	1.11%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0220870008	A -> G	LOC_Os02g34800.1	upstream_gene_variant ; 4670.0bp to feature; MODIFIER	silent_mutation	Average:49.35; most accessible tissue: Callus, score: 82.045	N	N	N	N
vg0220870008	A -> G	LOC_Os02g34820.1	downstream_gene_variant ; 3727.0bp to feature; MODIFIER	silent_mutation	Average:49.35; most accessible tissue: Callus, score: 82.045	N	N	N	N
vg0220870008	A -> G	LOC_Os02g34810.1	intron_variant ; MODIFIER	silent_mutation	Average:49.35; most accessible tissue: Callus, score: 82.045	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0220870008	NA	6.01E-19	mr1242	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220870008	NA	3.19E-23	mr1375	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220870008	NA	4.03E-20	mr1754	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220870008	NA	8.25E-19	mr1767	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220870008	NA	1.52E-20	mr1838	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220870008	NA	7.45E-14	mr1909	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220870008	NA	2.35E-11	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 7 of 7 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0220870008:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact